Description :
From Genome Similarity Track
Location :
contig_60:291379- 292827
Transcript NameFunction/comments
g9106.t1hypothetical protein PHYSODRAFT_343894

Sequence
1448 bases(100 bases per row)
ATCGGGATGTGCGTGTAGCCCGTGTCGACGAGTTTGAGCACCTTGCGGTTCGTCAAGTCAACGTGTGCCACGAGGCCGTCGATCGGGTGACCGTACATGG
CGTGTGTATTCTCGACCTTGAGGAAGCTGAGCACTCGAATCATGCGGTTACCTTCCTCGCCTTCGTAGCCAAAGACTCCGGCCGAGAACTGCTCTCCACG
CACCATGTCGAGGTCGGTGATACCACGCTTGGCCAGCGCCTCGACGTAGGCGGGGTCGGCCTTGCAAATCGAGTCGCCGTCCCAGTAGTCCTGGTCCAGG
ATCGGGATCTGCCCGTCAGTCTTGGGGTCGAACTCCACCTCCTTGACAACGCGGCGTGCCACGACGTCCACGACGAAGTCGCGCGTGGTGTTGGTACTCT
GGTCGAGCACGAGGGCGCCGACCTCACGCGGGATCTCCGTAAGTTGTCCAGCCTCGAACTTGGCCAGTGTAGCGTGGTCCGGCTCAAACAGCATTACGTA
CACGTAGCGCAGCTCCGAGCCGGAGTACCCGGCGTCCGCGAGCACTTGCTTCACTGTGCGGACCTCATCGGCCGTGACGGGATCAAGTGGGTGCTTGATG
GCCTTGGACGGGGCGTGGACACTTGGGGCCATTGGCGCTGGGATGCAGGAATGCGGTCGGAGGCAAATCCGAAAGTGAAAGACTCAATGCCGCCATCGCG
TTCTTCTAGCCGCGTCCGCCATGTGGACGTCATTGATCTAGAGGGCCAAGAGTCATGACCTCCACATGCTGGTTCACCCAGCTGGCCCCATACAGCGCCA
CGAGAAACCCGCGCTTAGCCGTATGATGTTACGCATTTCATGTTAATCTTCATCGCCCAAAACGTCTAGTGATCGGTCTCCGATGTCAGCGGTACAGGCG
AGACCAGCTGGTGATCAAGTTCTACGATTGGTGTTCTGGCGCCTCACGCGCCTCGAGTCACAGCCCGAGGCAGTAACATGGGTCCATGTTTGGGTGTAAT
ACCCCTGCGGCTCCACAAGAAGCTCCGCATCAAGAGGAGGCAAGAATACTCTCGGCCGGCGGTTCGATGAAACAGAGCCTCTTCTCCACCTACCGGGATA
GCTCCAGGTTTCCGTGAGTTGCAATCACTACTACATGTATTGGTAGTGTAGTTCGGTTGCTCATTTGCACGTTTTGAAATTATCCTAACGCTGTCAGTAC
CATGGTACTACATGTAGTAACGTTGATGGGTACACTTCTTTGCTTCCTCTTCGACAGGTGAGCCTTATCTCAGTGTGTGGCGATCTGCAGCACTGCAGCA
CTAGGTCGGACTCTGTTGGCTTGTTCATGCCACGCCATTTTCAAAATAGCATTTCTAATTAACCGTATCATCATCATCGATGTCAGCATTGAAGCCGCGC
GGACAGTTGATGACGAGCAGTACATTGAACGAACAGCGCTCATTTACA