Description :
From Genome Similarity Track
Location :
Scaffold_132:29134- 30757
Transcript NameFunction/comments
Phyci_242488Major Facilitator Superfamily (MFS)

Sequence
1623 bases(100 bases per row)
TCACGAGCTCGACTCTCACTTTCGAATTCGCCTTCCAGTGCCGACACGGTCTTCCAGTCCAAGCCCCAAATCTCCAAAGTCCTCCAACTGAGATGCCTCG
CTCCCCGGGCCCCGACCAAGCAACGGACTACGCGATCGCGATGTCGCCGGCGGTGAACAACACCAACGAGCCGTTCTTGAGCCTCGAAGGGCGAGCCATT
GGCGCGCGGtggattgtgtacacgtctgcggccgtcgctatgctggaggccttccactacggttggtcgagtcaccagatcaacctgcacaagttcaaca
acaccgaggactgcaatgctcgccccgtcgaggagggcacctgcatcatgttcccgggtcacaccaagacgacgtggacactgctgtctaacgcatggat
cgttggtggcatgcttgggagttttctgtctggaatcccgtccaacaagtacggtcgtcgcatgacgctgcgcttcaacacggtcatcatggtggttgcg
tcgatgatccaagtcctggcgcccaccgccttttggttcggctttggtcggttcgttgccggaatcgccaacggtatcgccatggctgtggtcaacacgt
tcctgagcgagatctccaccccacacaaccgccacgctctcggaaccaatacgcacctggctgccacgctcggcatcttaggcgttgcaacgaccttctg
gtactggaacacgacgtcgggcttccgctggatcgccggcattccgattgtactcgccgcgggttacctcgtgtgctcctacttcttcatggtcgagagt
ccggtgtggcttgtttctaaaggccgtgagcacgaagccgagcgcgaaatcgctcgcctctacggcaaagagcacgtCGAGGCCATGATGAGCTGGATCC
AGGCGCGCGACACCCGCAACAAACTGCCGTCGACACTGAGTGGAGAGTTCGTGGAGGTGGAGGCCGAAAGTCCGTGGACGATTCTGACCAAGCCCAAGTT
CCGCAAGCAGCTTGTTGTGGCTCTCGGACTGACCTGCATCAACcagctcgtcggaatcaacgccgtgttctggtactcgtcttcgatcttgactgcagcc
ggcatcccggatgcgcgcttgggtgttgttatcattgatatccttaatgtcgttccggtgccaatcgcggcgtacgcgacgcagttcctgcccaagcgtg
cgatgttgctttggggaatcgctctgatggcgctgtgctgcatcggaatgacgttctccatggtctacagcgtgggttggctctccgtcactatgctcgg
catctacgttgttggctacgacgtgagcatcggtccgctgctctggcccatgatcgcagagttcttccccgactcggcacgcggcgccgctgtaggcatc
tgtgtcttcctgaagtggacgtgcgcgcttatcatcggcatcgcattcccgtacgtccaggacgccatcaccgactacagcttcacgccgttcctgggca
cgacgatcctgtccatcatcttcatctacttcatggtgccggagacgtcggacTTGACGATCGCCGAGATCCAGGACGGCTTCCGTGGCGACCAGAACCT
GCACTCGGTCAAGAGCCAGCAGT