Description :
From Genome Similarity Track
Location :
Scaffold_1488:2913- 4815
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1488-snap-gene-0.4HSF-type DNA-binding

Sequence
1902 bases(100 bases per row)
GTCGGCGCCGTCTCGATACGCATCTGGTTCTCCAGCGACGCCTGCGCCTTCTGCACGAGCAGCGCCAGCAGCGACCGGTTCAGCAATTTCTTGACGTGTG
GGGGGATGCGCTTTTCCACCGAGTCCTGCACGGCGCGCGGCAGCTCGCGCGAGATGAACTTGAGGATCTCCACGCGGTACATGCACGCGGCTTCTGAGTT
GGCCGCGTGCTGCTGTTGCGACACGGGTGAGCTGGGCTCCTGCACGCGCGCGAGCAGCTGGCGGATGTCCGACACCACCGCGTCCGCGACGGCGTCCACT
TCCTCGGACGACGGTTGCTGTTGCTGGATACGGATGAAGCCCAGGATACGCGCGATGATGCAACCGAGCAGCTCTCCGCGGGTCTGTGAGGCGGTCATGC
TGAGTTGTCGCACCGCTGCGTCCGGCGCGGTCTCGTGCATGGCGCTGCTATCATCGCGTATCCGCTTAAAGCCCGCCGATTGCTGGTTGGCGCTGGTGTT
CGCGGCGACCTCAGCGCGGTGGCGGTGCGAGGAAGTGGAGGATGGTGGCAGGGTCATCCCAGCTCGGTCTTGTCCACCGGTCGATGAATGACGCACCCCA
GCGCCTGGGAATGGGTTCCCGAAACGTGGGAGCTGCTGTGGATCGTAGTGGCGCTGATGGTGTTGCTGCTGCTGTTGTTGTGATGGTTGCTGCTGGCGGC
CGTACGAGCTCCAGTCCACGCGGTCAACAAACGACATGCCCGCTGGAGCACTGCCCGGTCCGCTACGGAATGAGAACACTGGGCTCAGGTGGCTCGCTGT
GGTGGTCGTCGCACCCGCCGGGATNNNNNNNNNNNNNNNNNNNNNNNNTCGAGATCACAGACTGCAGCGGACGCAGCTCGTACGTGGTAGCGGGGCTGCG
CTTCGCCCCGTCCTGCTTTGCATGCATGCCACTGCTGCTGCTGCTACTGCTGTGGCTGCTGATGGAGCTTGGGATCACGTGCGTACGCGACGATGAGGCT
GCTGATGCCGACGATGATGACGACTGAATCGGCACTTTGATCTGCGGTGGTGGCAGACCCTGGTGCAGCTGCAGGAGTGCATGGTGGTGCTGTTGTTGTT
GCTGCTGTTGCTGTCCTCCGTGGACGACCATGGACGGAAGCTGCGGGCGGTGTGCTTCACGTCCACTTTGCGACAACGACGCATGTCCTCCTGTAGCGGA
CGATGACGACGAGGGCGTCGACGATGGATGGTAATCGTACATGGGCGTCCCTGGCACTGTAATTGGCGCAACTGGTGGCGTGGCTCCTCCACTTTGAGTT
CTGCTGGTCATGAGCGCCTGCATGACGCTCATCATGTGCTTGTTCAGCTGCTGGACCTGCTCCTTGAGCCCAAACACTTCGGCGCGCAGTTCGTCCATCT
CGGCGCGCTCAATTGTCGAGCGTCCATCCGCGATCGTGCGGCGCTTAATCTCCCTCAGCAAATCCTTGCGGCCGCGCACAAACTTGTCGTGGCGGAACTC
CCACCACTCCTTCGGGTCCACACTGGCTGCGGTCTCAGCGTCCACGCGGACCTTCCGGAACCCGTAGAAGTTGAGCTGTCGCACGAACGAGCTGAAGTTC
TTGTGCTTGAAGTAGACCGGGATGACGTGCTCCGCGAATTCGATGGGCTTCTTCACGATGAAGCTGTCGCCTGCTGGTTGGGACCAGCCGGCGATCTCCG
GCGCGCACTTCTCGAGCATCTCGTACGTCTTCTCCAGGAACATGGGCGGGTCCTCCAGGCGCCGGCGTTTGGCGGCGATGGCCGAGCCCTCGCTGCCATT
GGGCGTGTTCAGTCCGCTGTCATCGGCGGGGGACGTCGGCGCAGAGGCCACGGATGTCGGGGACGTCGTGTTGGTGCCGGTTGTCGCCGCGTCGATGCGT
AG