Description :
From Genome Similarity Track
Location :
Scaffold_586:2912- 7755
Transcript NameFunction/comments
g16213.t1hypothetical protein
g16214.t1hypothetical protein
g16215.t1hypothetical protein

Sequence
4843 bases(100 bases per row)
AATCGCTGCTGATTGGACAAAATAAACCGCCTTTCAACAACGTTTCTTTTCATTCCCATACGTGGTCGAGTTTCAGAGAGATTCCAGGCAAATTCTCCCG
GTGGTGAAGGGCGGCTCGGCGACAGAGACAATCGACGCATGCCTGAAGTCTTCCGGACTGTGGCCACTTTCCAGAAGGTGCGTCTGACAGAGAACATGCG
TGTTCGCACGGCTGCCACGTCCGATAGTGCTGCAGAAATGGCTGCGTTTTCCGAGTACCTGCTGAAGGTTGGAGAGGGGAGACACGAGGTACACAATGAT
CTGGGAAATGACTACATGAAGATTCCACGTGACATGCTCATCGACAACCCCGCCGGTGATCCAGATGAGGACGAGGAGATCCGACCGGGAGCTATTCCGC
GAGGTATGCGGCGCATGATCGACGAGATGTACGCCGACATCAACAATTCGGAAGTCGCAACGGACGAGTACTTTGCGAGTCGCACCATCCTCACTACCAC
GAACGCGATAGTCCATCGTATCAACGAAGCCGTAGCGGATCGCATGACTGGGCCAGCTCGAGAATATGTGTCCACGGACTCAGTGGAGGATGACTAGGAC
GGGAACTTATTCGAGCAGGAGGTGCTCAACTCCCTGAACATCAGTGGTATCCCACCCCACAAGCTGAAACTCAAGAAGGGGATGCCGATCATCATGATGC
GGAACTTAAATCCCGACCTGGGGTTGTGCAACGGAACGCGTCTGCGAATCGTCGAACTCAAAGATCATGTCATCCATGCCACCATCATGGCCGGCGACAG
ACAAGGCCAGCATGTGTTGATCCCGCGCATCGTGTTCATCAGCGATGGCGACATCCGCGATTTCCCATTTCGACTGAGACGCAGGCAGTTTCCTATCCAG
ACTGCCTTTGCCATGACGATCAACAAGGCGCAGGGACAAACGGTGCAGTACCTGGGACTGTACTTGGCGACTCCTTGCTTTTCCCACGGTCAGCTGTATG
TGGCCATGTCAAGGGTTACGTCGAGATCGAGATTCAAGGCGTTGGTCGAGTATCCAGAGCGGGAGGAAGAAGACGGAGTGTACACGGCGAACATAGTGTA
CCGACAGCTGTTCGAGAGGGCGTAGGCAGTGACTTCGTGTGAATGCATATTTTACGAAAGGAATACATTTGTCACTTTGCATAGCGGTAATTGTTGAGAG
TCACCATTCCCCCTCGAGCGCAGCGAGTACGCCTGTGGTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAGCAGTGCATGCTAGACA
AGCGGAGGCGAAGCTTGCGAGCCGTAGCAGGCTTAGGGTTCGTACACACTAGAACCACGTGAGACGAGCGCAGCGAGTACGCCTGCGGTTTGAAGTCCGT
GTGCGAAGCACGCGGGTGAAAACACAGGACCAAGCAGTGCATGCTAGACAAGCGGAGGCGAAGCTTGCGAGCCGTAGCAGGCTTAGGGTTCGTACACACT
AGAACCACGTGAGACGAGCGCAGCGAGTACGCCTGCGGTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAGCAGTGCATGGTAGACA
AGCGAAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGGTTTTGATACAAGTCTACTGTAAAATATACTGATATAAAACATAACCCTGTCATAGTAAACAT
AGTAGTGAAGCGAGCTGGATGAGCGAGCGAACGGGCACCAACCAACCATGCACCCACCGCCCGCAACGCGGGCGGCGCTCGGCTAGTCTCCTACAAGTAA
CAGAGTAACCTGTCCGTCCGTCCGTCCGTCCGTCCGTCTGTCCGTCATTCCGTACGCACCTCGAGCGTAACGCAAATCCGGACTTTCCGTTGGCTATAAA
TAGCTGCCGAGCGCAGCGAAGGCGGCCTCCCCATTCGCTATTATTATAATTCGAGACCTCTCATTGGCTGTATATTCGAGCCTCTGCGCGATTGGCTATT
ATAATGCGTAGAGTGGACTACACCACATCGGAACTAGCCGAATGAAATCACTGCTGATTGGACAAAATAAACCGTCTTTCAACAACTTTTCTTTTCATTC
CCATACGTGGTCGAGTTTCAGAGAGATTCCAGGCAAATTCTCCAGGTGGTGAAGGGCGGCTCGGCGACAGAGACAATCGACGCATGCCTGAAGTCATCCG
AACGGTGGCCACTTTTCCAGAAGGTGCGTCTGACAGAGAACATGCGTGTTCGCACGGCTGCCACCTCCGATAGTGCTGCAGAAATGGCTGCGTTTTCCGA
GTACCTGTTGAAGGTTGGAGAGGGGAGACACGAGGTACACAATGATCTGGGAAATGACTACATCAAGATTCCACGTGACATGCTCATCGACAACCCGTCG
GTGATCCAGATGATGACGAGAAGATCCGACCGGGAGCTATTCCGCGAGGTATGCGGCGCATGATCGACGAGATGTACGCCGACATCAACAATTCGGAAGT
CGCAACGGACGAGTACTTTGCGAGTCGCACCATCCTCACCACCACGAACGCGATAGTCCATCGTATCAACGAAGCCGTAGCGGATCGCATGACTGGACCA
GCTCGAGAATATGTGTCCACGGACTCAGTGGAGGATGACGAGGACGGGAACTTATTCGAGCAGGAGGTGCTCAACTCCCTGAACATCAGTGGCATCCCAC
CCCACAAGCTGAAACTCAAGAAGGGGATGCCGATCATCATGATGCGGAACTTAAATCCCGACCTGGGGTTGTGCAACGGAACACGCCTGCGAATCGTCGA
ACTCAAAGATCATGTCATCCATGCCACCATCATGGCCGGCGACAGGCAAGGCCAGCATGTGTTGATCCCGCGCATCGTGTTCATCAGCGATGGCGACATC
CGCGATTTCCCATTTCGACTGAGACGCAGGCAGTTTCCTATCCAGACTGCCTTTGCCATGACGATCAACAAGGCGCAGGGACAAACGGTGCAGTACCTGG
GACTGTACTTGGCGACTCCTTGCTTTTCCCACGGTCAGCTGTATGTGGCCATGTCAAGGGTTACGTCGAGGTCGAGATTCAAGGCGTTGGTCGAGTATCC
AGAGCGGGAGGAAGAAGACGGAGTGTACACGGCGAACATAGTGTACCGACAGCTGTTCGAGAGGGCGTAGGCAGCGACTTCGTGTGAATGCATATTTTAC
GAAAGGAATACATTTGTCACTTTGCATAGCGGTAATTGTTGAGAGTCACCATTCCCCCTCGAGCGCAGCGAGCACGCCTGTGGTTTGAAGTCCGTGTGCG
AAGCACGCGGGTGAAAACCCAGGATCGAACAGTGCATGCTAGACAAGCGGAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGGTTCGTACACACGGGAAC
CACGTGAGACGAGCGCAGCGAGTACGCCTGTGGTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAGCAGTGCATGCTAGACAAGCGA
AGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGGTTCGTACACACGGGAACCACGTGAGACGAGCGCAGCGAGTACGCCTGTGGTTTGAAGTCCGTGTGCG
AAGCACGCGGGTGAAAACCCAGGACCAAACAGTGCATGCTAGACAAGCGAAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGGTTTTGATACAAGTCTAC
TGTAAAATATACTGATATAAAACATAAGCCTGTCATAGTAAAAATAGTAGTGAAGCGAGCTGGATGAGCGAGCGAACGGGCACCAACCAACCATGCACCC
ACCGCCCGCAACGCGGGCGGCGCTCGGCTAGTCCCCTACAAGTAACAGAGTAACCTGTCCGTCCGTCCGTCCGTCATTCCGTACGCACCTCGAGCGTAAC
GCAAATCCGGACTTTCCGTTGGCTATAAATAGCTGCCGAGCGCAGCGAAGGCGGCCTCCCCATTCGCCAATACTATAATTCGAGCCCTCTCATTGGCTAT
TTAGTGGAGCCTCTGCGCGATTGGCTATTATAATGCGTAGAGTGGACTACACCACATCGGAACTAGCCGAATGAAATCGCTGCTGATTGGACAAAATAAA
CCGCCTTTCAACAACGTTTCTTTTCATTCCCATACGTGGTCGAGTTTCAGAGAGATTCCAGGCAAATTCTCCCGGTGGTGAAGGGCGGCTCGGCGACAGA
GACAATCGACGCATGCCTGAAGTCATCCGAACTGTGGCCACTTTTCCAGAAGGTGCGTCTGACAGAGAACATGCGTGTTCGCACGGCTGCCACGTCCGAT
AGTGCTGCAGAAATGGCTGCGTTTTCCGAGTACCTGCTGAAGGTTGGAGAGGGGAGACACGAGGTACACAATGATCTGGGAAATGACTACATGAAGATTC
CACGTGACATGCTCATCGACAACCCCGCCGGTGATCCAGATGAGGACGAGGAGATCCGACCGGGAGCTACTCCGCGAGGTATGCGGCGCATGATCGACGA
GATGTACGCCGACATCAACAATTCGGAAGTCGCAACGGACGAGTACTTTGCGAGTCGCACCATCCTCACCACCACGAACGCGATAGTCCATCGTATCAAC
GAAGCCGTAGCGGATCGCATGACTGGACCAGCTCGAGAATATGTGTCCACAGACTCAGTGGAGGATGACGAGGACGGGAACTTATTCGAGCAGGAGGTGC
TCAACTCCCTGAACATCAGTGGCATCCCACCCCACAAGCTGAAACTCAAGAAGGGGATGCCGATCATCATGATGCGGAACTTAAATCCCGACCTGGGGTT
GTGCAACGGAACACGCCTGCGAATCGTCGAACTCAAAGATCAT