Description :
From Genome Similarity Track
Location :
Scaffold_1307:2912- 4223
Sequence
1311 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNCGTGCTATATGCACGTTTTAATGCCAACACTACGAGTGGCGACTCAAGGCTGATCATCGTCAGCCTCCATGTCGCCGGCGCCCGACGTCCACTGCG
CGCGCTCCTCGACTCAGGAGCGACAAACAACTTCTTCCGCGCGTCGTGTCTGTCGGTGCTTCCTGCGAGCGTTCGCGTCCGGAAGGGTCCGGGCGAGGTG
GAAGTCAAGCTTACGGATGGCAAGGCCCACCGCGTCGCGCGACGCGAGGTGTCCCTGCCGTACACGTTCGACGGCTTCCGCAGCAACGGCGACTTCCTGG
TGATCGAGATGAATTACGCGTTCGACTGCATTCTGGGGATCCCGTGGCTTGCACGGTATCAGCCAGAGATTGACCGGCTGGCTCGGTCAGTCAAGCGTCG
ACGTGGCTTCGACTTACGCGAAGTGTTCACGCATCTCTTGGTGGCTCCAAGAGACTGGCCTCACGTTACCGTCGTGGACAAGACAGCCACGACGCAAGTT
GTGCACAGAGCGAGCGATGGCCCTCTCTGCATGGCATGTGCCGTGCTGTTGGATGATGATGATGTCCGGATGACATCGCGTGGGCGCGATGACGGAGCGA
CGTGCGCTCCCACACAGTGAGAACAAGTCGGCGGTCGAGCATGGGTTCCCGTCGAGCTACAAGTCGGCGGTCGAGCATGGGTTCCCGTCGAGCTACAAGT
CGGCGGTCGAGCATGGGTTCCCGTCGAGCAACGAGTCGACGGTCGAGCATGGGTTCCCGTCGAGCAACGAGTCGACGGTCGAGCATGGGTTCCCGTCGAG
CAACGAGTCGACGGTCGAGCGTGGGTTCCCGTCGCACAATGAGACGGCGGTCGAGCGTGGGTTCCCGTCGAGCAACGAGTCGACGGTCGAGCGTGGGTTC
CCGTCGCACAATGAGACGGCGGTCGAGCGTGGGTTCCCGTCGAGCACGATGTCGACGGTCGAGCGTGGGTTCCCGTCGCACAATGAGACGGCGGTCGAGC
GTGGATTCCCG