Description :
From Genome Similarity Track
Location :
Scaffold_43:291166- 293861
Sequence
2695 bases(100 bases per row)
AAAACCCAGTGTCAATCGTCGGAGGTCTTCAATTGTACCTACGTCACACCCTAACGTTACTGATGTGGAACATGCGTATCGAAAGAATAAGTTACAGATT
CTGATAGAATCTCGAGTGCTGTAAGCACTTTTCGGCTTATGGGGAGCTGCTCTGTTGGCTCTCCATCTATACGCAGAGTCAGTACCGAGCGTTCCGCAAT
GCGCAATGCAAGTAAAACCTTGGGGGACCGCGCTGCTATCTCACAAACACCCCACCCCAGTCTAGTGATGCTGTTTCTGGTGCGTGTGAACGTGACAAAT
GGTGAATTACCGATCGGTCTACTAGCAAATGATTTCCCAAAATCACTTATGGATATTGAATTCTGTGTCACCAATTTACGTATCTTACCCGATGATCTGG
ATTTAAAATGGCCAAAATTTGGAACGATCTGCTTTGAATCATGCAACCTATCCACAGTTCCTGCCTCGTTAGTTCGGCTTTCACCATACGTTACCTCTCT
TGCATTAAATCCGATCTCGAGTATCCCTGAATCGGTATCGACAGATACCGCTGGCTACCTCCACGTGGGTGGTACGCTTATCACTGAGCTACCGCGGTCA
GCAACTGTATTTCCATTTTTTAAGCTGCGAGTGGATCGCACCAATATTTCCTTCTTTTGGGACTGGATCGATCCAATGGTTGCCAAGGCAGGTCTGATAT
ACAATAGTCTTCCGACGGTATTAGCGACAGAGTCTCCGTATTGCGAAGAGTTGCAGCGAATTTTTGAAGGGAAGCAAACCAATTTTTCCACGACGTGGCG
CCAAGGGCAGTCAAGGATCTTGTCAGATGCGTCTTCAGGCAACTGGGCGACACTTAAAAAGGCCGTATCCTGCGGGGCTTGGACACAGACACTGTATCCT
ATTGAGTTTGAAGATCAGCACAGCAAGATCAATGCTGAAATGTAGCCATTGTGGGGTTTGAGATGCTTGTTTGCCAAGTGCCTTGTAATAAAATACTTCG
TAGCGTATTAGAGACTGAGAGTTGTTTGCAACTCTCAAATATAAATAACTTAATCTTTTTAGGAGAAGTGTAGCGCACTATTGATGTATACTATGTAAAC
GTTTCATTGCTACAATGTCTGTGCATTCAGCCCCAAATATTTTTTTTTACCAAACTTGAATTTTTATGGAAAATGCCCTCAAATTTAGCGACAAGTGGTG
GGAATATCTGGCAAGGGATTTGTCGTCAGAAAGTTAATTCGATACAGTACTTCTGGCTAGTGAGCGAGAGCGCTCCAACAGATGCTATGAAGCAACTTCA
CTTAACGATGGTGACGGATGTCTAGCTGAAGGATCCATTGGTGAACACCTTGGCCGAGTATGTGACGGTTTACAATGCGAAATTTCCAGATGCCACTATG
ATTGCTGCAGCGAAGTTGGTAGATAGGGCTAAAACAATTACAACGAAGCTGGAATCTGCGCAGCTTCAGATGTGGCTAAAGAATGGGGCGTCCGTCGTCG
ACGTGCACAAAATATGCTGCAGGATGTAAAAAGAAGCGACTTCGTCGGTGATCCACTCCTTTGCACGTGGGTCTCGTATAGTAACTGACAATCCGAGCGA
GAAGTCTAGTGTACGATGTTGGAGACTCGCTTAAGTCATAAACCTTCGCTACAAATTCATGAGGAAGCTAGAAAGTTTTCTAGCTTTAAAGCTACTGCAG
CTAAAATGTAGTCGGAAAGGATTCAGAGAAGTTTTGCGAGTGGGAATTTGAGCTATTTATGACATTAGGGCTTAACCGCGTGAAAGATGATGGCCTTCTG
GTAAAAATATTCCGGAGGTGGGTGAATTAGGCGGAGTCTCTTAATAAGAATAATCTGGATCGTCAAGAATCGTGGTTTTTGCCCGTTGGTTTAGTTACCG
ACGGGGTGAAATGATCGACACGGCGTGGGAAGCTCCAACTACCATGGAAATCGCGAGAAAGATAAAACCTGGCTAGACGCTCCCAAAGGTTGTCTTTCAC
TTTTTGCTCCTCGACAAAGCTGAGGAAGCGACCCTTTCTAATCGGAATTTTAAAGTGTGGGTAAAGTACGTGGAAGACTTCAACAGCCTGAATATAGACA
ATAAAGTCACAATAATCGCAATCATTCGAGCAAAAGAGCCAACATGGAGAAGAATGACATTAACACGAAAAAGCTGGCGACAGAGTCAGGATCTACCGGT
AGCTGGGAAGAAGCGCCTGGAAAACGCTTGAGGCTGTTGAGGTTAGGGCCCGTCACAGGGACCGCCTCTCCATCGTGCTCTCTATAAACTAATAATGAAG
AGACACGGGATTTTTGACTCTAATAAATAATGTACTAAAATGTCTGGAACATTTTAGTACGATGAATGGTAGCGGCAATTCTAGACTATGTTTCTGAATG
CCGCATACTAATTTCTTGTTAGTAGCCCGCTACTTTCTTAAACATTAATCTTACTTCTTCTTTTACTCCTTCCTACCCTGACTTCCTTCTACCTGCGCCC
AAGTTACCCGCAACAGAGACGATGGAGAGATATAACCACAGGCGCACGGAAAGAACCCACATAACCCCACGGAGAGCACGAGTAGCGGCGCATTTAAAAA
AAGATAAAAAAAAAAAAGTGACGCTGGCATTTTTTTTCAGCGCCGTTTTATTAAAATAAGGCTAATTTAATTTAATTTTAACTATTTAAATGCGC