Description :
From Genome Similarity Track
Location :
Scaffold_18:291088- 292186
Sequence
1098 bases(100 bases per row)
CTTTCAAGAACATACGTATTTCGATCCGAGAAGATATGGTCAATATAGAGATTGCATGTTGGTTATTCCTGTGGAGGTTGATTATCACACTACAAGATCC
TTGGCAATCCGCACTTTGCCGAGAAATCACTTGCTTGACGTGACCGTACGATAATTTGGAGTGGTGCGTTGATCAAGCTGGATGAGTTCGGCGCTGACTG
TCAGATTTTTCTGGCTCCTTACCTCGTGTGTCAGCCGATTCGTTCCTAATGAATATCGAGGACTGTTGTGCTGTTGTGAGCAAACAACCCGCGACTACTC
TTAAGAAAAGGTTGACACGGTACGGAGACAACTCAATTGATCGAGAAGAATGAGCTCGACTTGTTGCTCTGAAAAGAAGGAATATGAGACTTCCTCGACC
GCCAAATTACAATTTAACGTGCTTTGCTACAAAAACTCAGTCCAAAACAATTGAGTTTGGTACTCAGTGCTCACAGCAAGAAATGGTCAAGGAGCGTAGC
AATTACGTCCACCCCCTCTGCTGCGTAGGATGGATGAAGCTTGCATGGCTCGTGCAGTGATCCGCACGAGCCATGCAAGCTTCATGTCACGCAACGTGAC
GTCTTTTGCGTTGTCCTTTGAGAAGGTGGGTACGTATAAGATGCACGGACTGCTTACCGAGTAGTCGTAGCAACTTTTTTGGCGCTCCTACTGCAATCGG
TACAGCTGATACACTTATGTGCTTAGCTCGACTTGCATCAATAGTTGCGGACCGCTTGAGCGTGTATGTAGATACACCGGATGATCTGTCGGCGTCTACA
TACTTTATCTAGAATCATTCGTATCATAACCCATCGGGTTGTATTACAATCCCTACTTGCCAGAAAGCGTGGAATCTCATTTAATCTCCACATGATGATA
GGTTCTTCACTCCAGCATCAGGGACTTACTCTGCAGCTTGCCAAATTCACATTGGCTTTCTGTGCACCCTTTCGATCAGGGAATAGACTGCAATGAACGC
GTGATTGTTGTCGCCTGGAACCATTTGGGTGGGAAACCATATTTATAGAGCCGCGAAAAACGTGGTAGTTGTCAGAAGCACTTTGTTGCGTCTCGATG