Description :
From Genome Similarity Track
Location :
Scaffold_30:2910- 7243
Transcript NameFunction/comments
Aphas_H257_09982Ptype ATPase (PATPase) Superfamily putative

Sequence
4333 bases(100 bases per row)
AGCGCAACACAGTTTGCGTTTCGATGGCGGAGCCCTCCGAAAAGGCAAAGCCCGTTTGGTTTCGAATGATCCGCGGACTTTGGTGGGACGTTTCGTCGCC
GTACGTGGTGTCGTCCGTAGGCATTTTGTTCCACTCGCGCATCAAATGCGACGGCTCGGGGTAGAACAGCACTCGACCAGCACGCAGGATGAAGTTGGGC
AGGACCGCCACGACGCCAGACATGACCATACCCAGCCAGAACCACGCCTCCACACTCAACTCCTGGAACACATTGGACGCTTCGTACATCTCTAAAAAGT
CGGCGCCGAAAAGAGTGTACGCCGAGCAGAAGAACCACATGAACGCAAAGTAAAACACGAGCGTCCCATACACACCCACACAGTTGGGCATGGTCCAGTT
GCTCGTAAGCAGCGAAATCTGAAACGTCGACGCCACGATCAAGTACGTGTACGAGGCCACGCCGTCCGCCCACAACCCGAGGGGCGCGCCATGGAACACT
GCCGTGTCGGCTTCGACTTCGGAAAACCAATTGAAGTAGTACCCGTCGCATGTAAACGGCACCGAGCTCACGACGTACGCGTGCCAGATTCCGAGGCCGC
ACCAGCCGAGAAAGCTCGACATGTTGAACGACCGGTTGTCCAAGCCGTTGTGGTACAGCGTCGGGTACTGCATCAGCGCCGACGGACTCACGTCTTGGTT
GTACATGGCGAGGATCACAATCGGAATCGTCGAAAACAGCGCGTTGTACAGCGTGAACAAGATGCTAAAGTACATGAGCAGTCCGCTGTACAGCGTCTGC
GGCGCCATGAAGAACCCCGTGAACGACAGCGCAATGTTCTTCATGAACGAGAACAGGAGAAGCTTGGACACGCGCTTGTAGCTGTAGTTGCCGTGCACGA
GCACCAGTCGTTTCAGAAACCGAAACTGGGCAAACGAGTAGTCGCTCGACAGCACGGCCTGCCGCCCTTCTTTGCCGCTGATGCCGACGCCAACACTGGC
GGCTTGGATCATCGGGACGTCGTTCGCGCCGTCGCCAATCGCTAGGCTAACGTTCCCGGGGGTCCACAGCAGCGTCGGCTCCGTCACCAACCGGACCACA
GCGGCCTTTTGCGACGGCGAGCATCGACAGCACACGACCGACTTGCACTGCTGTGCCACGGCCAAGAACAAGTACTTGATGTCGTCGTCCAGCACGAGCG
CCAGCGTCTTGCCGTCGATGACCATCGCGTACTCGATCAGGTCATCGTCCGCCGTGTCCTGGGTGGACGATTCATTTGTCGGCGGGGGTTGCACGCCCAC
GGGTTCAAACTCCTTGGCAAACGGATCCATGCTGCTCACGGAACTTACGGCATCGTGATGTGGGAACACGTCCATGTTGATGTTGTTGACGTCGCTGGGG
CGCCGGCGCTTGCGATGCAGCTGCTTGGGCTGCTCGCGATACTTTCCAGACAGCATCGACAACACGTGATTCATGCACAGCACACAGACCCGCTTGAGCG
TTTGGAAGATGACCACCGAGATCGAGTCGTCCTTCTTGGTGCCCCACTTGTCCTCGACCATCTGCGCGTACAGCGCCTCCAGCGTGTCCGTGAGCTGCTC
CTTGTTGTTGCTGTCCAGCACAATCACGTCCATCGAGTCGTGGATCACCTCCGACGACATGCCCACGCTGATAGCCGTCTCCTTCTTGTCCCCTGTGAGC
ACCCAAAAGTTGATACCCGCCTTCCGCAGCGACGTGATGCACTCGCCGACGCCTTCCTGGAGCAGGTCCTCGATCGCCGTCGCCCCCAGCAGCGTCAGGC
CGCACTCGACGAGTTCTGCCGCCGCCGCCAACTTGGCCTTGTCCATCGACGCTTCGGCGTCGTCGTACATGAGTTTCCACGCCGCGTACTCTTCCGGCGG
GATCACGCGCATGGCGGTGGTCAGCGTCCGAAGGCCCTGTGACGCATAATCCTGCAAGTGGCCCTTGGTCACATGCAGCACGCCTTGGGGCTGCGCCGGG
TCGAGCCGATCGAAGATGACGTCGTCCGCGCCTTTGCAGTAGATGTGCACCCGTCCCGACGGGGTGCGGCAGATCACAGACATGCGCTTGCGGTCGCTCG
TGAACTCGACCACGTGCAAAATCTCAAACTCGGCTGCAACCCCTTGAATCGTCACTTCGCACTTGGACCCGCGGCGGTTGGTGAGGCAGTACGACAGGTC
GTGCGCCGCCAAGCACAGCGCCTGTTCGTCTGGCGACGACGCTTGGTACCGGACGTCCGTTTCCATTTGCGGCATGGCCGTATTACATACCATGAGGAGG
GTTAAAAACTCGTGGATGTGGTGGGCCGATCCGTGCTTGTTGTTCAATCGATGCAACAGCCGCGGGTCGTTGAAGCGGGTGCCACGCCGCGCCGACTATG
CCAGTTCCAACGATGAAAGCACCCAAAATGACTGACTGAAACCAACTATTACCTACCTTGTCCAAGTCCATGTCGTTGTACTTCAAGCCCGCGACGGTGC
ACTTGGCAAACACCATTTCGTTGCGCGTGAGGGTCCCCGTTTTGTCGGAAAAGATGTACTTAATCTGGCCCAAGTCTTCGTTGATGTTGCTGTTGCGAGC
CTCCGCGGGCATGTCCGACGCAGCATCGTACATGGCCAGGTCGCTCTCGATGTACCGCGCGTGCACAAACCGGATGCCTTCCATGGTTACGTACATGGAC
AGCGGAATGAGATTGTTGAACAGGATCACGTAGCTCAGGAAGATGTAGTCGCCCCGCTTGGCGCCGTCGTTCCCGCCGTAGAGGTAGGCGGGGTACACGG
ACGTGGACATGGTCGTGTTGGTGGTGCTCCACCGCCGGTTCCCGAGCGAGCAGTACAGCGAAATCGTAAACAGCACCACCATCACAATCACAAACATGCT
GTCCAGGGACCGCTCCACGAGACTGCGCTTGTTCTTTCTCACTCCGTCCGACGCGTTCAGGGCTATTTTGGTCTCTGAGCCTGTGTACAGCACCATGGCC
ACGGTCCACTCGGAGCTCACAAGGTCGCACCCTCGAAGCAACAGGTTGTCGATGGACGCCGACATGTGACCTTCATTCAGGTCGACGTACCCGCTCCACT
CGAACATGTTCTTGTTTGGCGCGTCGCAAGAGACGGACACGCGGAGGGTCGCGAGGGCGGTGGGATTCGCAAACGTGTTGGTTGTCAGCGCTTGGCGGAT
CTTCATGTTGGTCTCCCCGTCCAAATTGGCCGTCTGGACGTAGCACATGCCGTTCTTGTTGTCCGTGGCCAGCATGAGGCAGTCCGCGGGCACTTCGTCG
CCAGCTTTGAGCACGATCAAGTCGCCCACGGCTACATCTTTCCACGTCCTGTCCAAAGTTGCGTCGCCCTCGTCTCGACATAGCACGCGCACGGGCTTGG
AGTTGACTTTGAAGTCGGATTTATGCCGACGTAGGTCTTCCGACACGTCTTTGATTGCCGCCGTGGTAAACACAATCAGCAGCGGAATGAGGCTGGCCTC
GGGGCCGACGGGCGAAAAGCTGAAAAAGCACAGACCCACCACGATGCTCGTGTACACGTTGGCCAGACGGCTGAACTGCATCTTGAAAAACACGAAAAAG
AAGTTCCAGAACGTGTACTTGCTTGTGTGGATCGTGTTGGACGCGAACGACGAGTCTGCCGCCCCCAATGTCACAGATCGCTTCGCCACGGGTTCTACTC
AAACCAGAGTTTTGGAACCATATTCTAGCCAATCAACAGACATCCATCGTCGAAGTATGCGACATGGTACCGTTCACGTCGAGTTTGGAGACTTTGGGCT
CGGCGACAAAAGCCGCGCGTTCGCATTCGCGTTGGTTCACGACAGACTTGACAATGCGACGCAGCTTCCACCCGTACAACAGCCCCGTGATGTTGCATAA
GAACACGATCACCGACAGCACCAGATGAATCCAATACGCGGTTTCTTTGGACAGGTCTTCGGCTTCTTCGCCGGTGTAGGTGGACGAAGGCGACCCATTC
CACCCCAGGACATACCACAGGACGTCCACGACGATGCTCAGCTGCATGCCCAGTTTGTACAAGAGGAGGGATCGAGACGCTAAGTGATTCGCGCCGTGCC
ATCCAAAGATCAGGGTGAGGTACTACTCGAGTCCATCAGCGACGTCGAGCATGCATGGAAGGGTGTATGTACCAAGATGAAGACTGGAACGGTGGAGCGG
AAGGAATAGCCTAGCAAAATCGGCAGGAACCGAATCGTGCACAGCGCCCCTTGCCAAATGATGACAAATTTCAACACTTTTCGCGCCTCGTACAGCGTAG
TCCGCTTGAGGAAGCAAAACACGCTCTCGAGGA