Description :
From Genome Similarity Track
Location :
Scaffold_2038:291- 6201
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2038-snap-gene-0.1Conserved gene of unknown function

Sequence
5910 bases(100 bases per row)
ACGCAGGAGCTGACGAGCCAGTTACAACAGTTCAAGATCGAGAACGAGCACCTGCAGAAGCAGCTTCAAGACAAGGACTTTTTGCTCGAGCAAATGGACT
CGTACCGCTCGCGGGCGGACGATAGTGAGGCCAAGGCAAGCACACTACGTGGTGAGCTAACCGCGCTGAACGGTCAGCTCGCTGCCAAGGAATCCGAGAT
GAATCAAGTGTGCACTAAGTGCGAAGATCTCAAACGCGAGCTGTCGGAGATGACGACGCTGTACGAGAAGGTGAACATGGGGCGAAGCCAGAGCGACTCG
CAGCTCTGCGAGGCGCAGGCGGCTCTCAGTGCGATGCAAGGGGTCAAGCAGAACCTCGAGTCGGTGCAGGCTCGAATGGAAGACGTTTCCAAGGAAAACA
TGCAGCTCCACGAGAAGGTCTTCCAGAAGGAATCCGAGATCGCTGCGTGCAAGGGCGACGTGCAACGCCTGACTGCAGAGCTGGCGCAGCTGCAGCAGAC
TGTGACGGCGTCGAAATCGGACAGCTTCCAGCGAAAGCAGCAGGCCGACGCGCTCGAGGCTACCAAGAAGAAGGTGGACGACGGACTCCGCGAAGCGTTG
GCGAAAGCGGCGGCGCTGGAGAAGAAAAACCAAGAGCTCACTGCAACGGTCGAGGCAGTAACCAAGGACAGCAACGAGAAGCGCCAAAAGGCCAAGGCCC
TGGTCATTTCGCTCACGAACGAGAAGCAGTCGTGTGTCGATGCGAAGGCGGACCTGCAGAAAGAAGTGGATCGCCTGCGCATGGAGTTGAACCAAAAGAA
CGTGGAAAACGAGCGCCGACTCAAGCAGATTCAAGAGGAGAACCAGCAGCGGATGGCACAGACCGCGACCGCGTCGCAAANNNNNNNNNNTGATGCGCTC
GAGGCTGCCAAGAAGAAGGCGGACGACGGCCTTCGCGACGCGTTGGCGAAAGCGGCGGCGCTGGTGAAGAAGAACCAAGAGCTCACTGCGACAGTCGAGG
CAGTGACCAAGGACAGCAACGAGAAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAACGAACGCCGACTCAAGCAGATCCAAGAGGAGAACCAGCAGCGCAT
GGCGCAGACCGCGACCGCGTCGCAAAGCTTGACTGAGGAGATCGCGACGCTCAAGCAGGCGCTGATGCTCGTCCAAGAATCGGAGCGAAGCCAGCAGCGC
GCCAAAGAACTCGCCAATGCCAAGCGCGAGGTCGAAGACTCGAACAAGAAGCGCCTAGCGGCCAAGGCCGAGACGCAGAAGCTTGCTGTGGAGCTTGAGA
GCGTCCAGAAGAGCCTGAACCAGTTAGCCGACGGAGCAGCGACCTCGTGCTCGACTAGCGTCAAGAAAATGAACCATCTCCACGATCGCGTGAGCGAGGC
GCTTCACGTGCTCGAGAAGCGCGCGTCGGCGTCGGGTAAAAAGGACGGTTCGCCCTCGTCTTCGCCGACCTCTCGCGACGTGCAGGTCGAAGACCTTCGG
GCCGCCGAGTCGGCCGGTCGCCCTCTGTCTCCCACCACGGGCGCCAAGCGAGTCGAGGAGAACATTGCGAGGGTCACCGACAAGGTAAGAAAGATGCGGC
GATCCCCACAACCGCACGAACTGACTCGGGAGGTTTGCTTGTCGTCTCATTCCATAGCTCGCCGTGCTGGTCGACGTAACGGAGAAGCTCTGCGATCTGT
CCATTGAGCAAAACGATGTCCATCTCAAGGACGTCGTCGTCGACAAGTTTACGCAGCTCTTCACCCAGTGCTTCTCCGAGAAGCTGCGCGCCGCGTACTC
CAAAGTGGAAGACGCGGCCGAGAGCGGCGGTCTTGCAAGCGCCAAAGCGTAGGTTCAGCAGGCTCTTTACCTATTTACAATAAAAAAACAAGTCCCCTAG
CGCATTCTTCTTGGTCTAGCTCGATCGCTTTCGTTCGTCCGCATACCTCTTGTGTGGACGCTTTGAGGAATCGCACTTAGCGCAGCTCCACCGTGAAATC
GTCTTCGATTGCATCTTCTNNNNNNNNNNCACAAGCGCCAAAGCGTAGGTACAGCAGGCTCTTCCCCTATTTACAATAAAACAAATTGCCCTCGCGCATT
CTTCATCTTCTAGCGCTATTGCTTTCGTTCGCCCGCATGCCGCGGTGTGGACGCTTTAAGCAATCGCACTTAGCTCAGCTCCACCGCTAGATCGTCTTCG
ATTGCATCTTCTTGAGACGTTGCGACCGTCGGGCCGTCTTCTTCGTTGGCCATCGTTTCTCTCTCGGTAGACGCCATGCGGTCGCTCTCTCCGACGGCTT
GTCGATCTCGTTCGCCGGCTTGTTCGTCGTCCTCTTTCGACCCCATGACTGCGTCTTCTTCTTCGACAGGCGGTGTGCGCTCGCCTGCTGACAAAGAGTC
TTCCTGCGCCGGGAAGAGCTGCTCGTAAAACGCCGGGCCCTTGGATTGACACTTCTCCACCAGCACGTGCATAAGGGCGTGGAAGCGCGCACCAGCGAGC
GCGCTGTTGCCGCTCTCATNNNNNNNNNNNNNNNCGTGGCTCGTCTCGTGGCGACGGAGCAACGCCGAGAGCCGGCGAATAACGCTCTTGACGTGCTCGA
CTATCTCGTCGTGGGCACTCATGATGCTGCGCCGTTCCAGCGCCGCGAGCACCTCGTCGTTTGCCGCGCCGGCGTTGTTACTGCGTTGCGTCGGCTTCGT
GAGCTCCACGTACGCGAGGAGCTGATCGAGCAGCTCATCCCACACGGACGCGAACCGCGGCAGCAGCAGCAGTTGGTCGAGTTGCTCACACGCGACCCAT
GACACCATTTCCACGACCAGGAGGTGCGGGCGCAGCGCCAACGGATCCTTCACGATGGACGGGCGACGCCGACGACCAGACGGCGTGCGATCTTTCACAG
AGGCGTCGCGCGGCATGGGCTTGAGCGCGAGTTTGGGCGGCACATTCTGCTCATAAAACGCAAACGAGCTGCTCACGAGTGTACTGCCGCCGTCGTCCAA
ACTCGCGCTTCGCTTCAAGGTCGCGTGAAGCCGTGACTTTCGACTCAACAGTTCCGAGCTGATGGTAAGCAGTCCTGAGCCCACAATCTCGAGCCACGCA
CCACCACTAAGCGAGCCGCGATTGCGAGCGGACAATATCATGGCACGAAGAAACTCGAGCGATACGATCGCCATCTCGTTGACTTGCGTCGAGATGGATT
CGCCGTCGGCTGGTGCACTGCATGACCGCAGCGAGTGGCGACACAGCAGCACCATGCCACCAATCTGACGTAGCCGTTCCTCTTCCTCGACCGCGATATC
ATTTGTGTCGAGCCGCTGAAAGAGCTGGGTGAGGAGCTCCAATGGACGGCGNNNNNNNNNNCTTGCGCTTCGCTTCAAGGTCGCATGAAGCCGTGACTTT
CGACTCAGCAGTTCCGAGCTGATGGTAAGCNNNNNNNNNNAAGCCGTTCCTCTTCCTCTACCGCGATATCATTCGTGTCGAGCCGCTCAAAGAGCTGGTT
GAGGAGCTCCAATGGACGGCGCCGCGGCCACCGTATGGAAGCTGACGGGTCCGACGAGTCCGGTTCATCCTGAAGCGCAAACAGCAGCGTCTTCGTGTAA
AGCTCCATCAACGAGAAGGTCGTCTCGACCTCAGCCAGCCAGACCTCGCTCGCGATGAGCTTTTCCAGAAACGCAAACGCATGAATGGAAGCGTGGGGCT
GCTCAGTCGCCCAACCAATCAAATTGGACACCGTCAGCCATTCGCCACGTTCAAAGTTCACGCGACGAAGATCGATCGAATCAGCGACTCGCTTCAGCCC
AGTGAACAGAAGAGTGAGGTACGGTCGAAGCAGATCGTCGTCGTCAGCACTCATATCGACAAGTGCAGTCAGCATACCCATCAACAGCCCCAGCGTCTTC
TCGCGACGATCCTTCAGCACCAGTAGGAGTAGTCCTTCGATGGCCTTTGCCAGTATGTACGCTGCGCAGTCGTNNNNNNNNNNGCGGTCCTTCAGCACCA
GTAGCAGTAGTCCTTCGATGGCCTTCGCTAGTATGTACGCTGCGCAGTCGTATCCAACCCCGTTCACGACAGCGTTCTTCAGGAGAATCGGTCGGATAAG
CGACGGCAGATTCAGATAGTGAAGCTCGAGGGCGTTCCAAAGACCGTCGACCTGCTCGTGAATGGAATCACGGGGTAGAGCTGCAAGAAGTCGGGATAGG
ATGTGCTCAAAGAGAACACACCCAGCCGGACTGAGGAGGCGACAATGGCCTGAGGCGGCTCGACTCACGTTTTCTTCTGGTTGGATCGGCGATGACCTGG
TTCCCGGAAAGGTAGACATCCTGCTCTCCGTCGATGCACTTTTCGGGGATCCGGTAAAAGCTTCGTCGAGCTCGTCGTGGAGTGCGCGCACGACCTCATT
CAATGCAGGAAGTGGTAAGACAGACAGCTCGTCTAGCAGGCGTTCCACATGATACGGTTGAAGAGTCTGACGAATCCACTCCCTTGTGCCAAAGGCGATT
GGCTGGTGCGTGGTGCCTTGCGTCGGCATCTTTGGTTCTGGTTTAATGAGGAGGTCGCGTGCGTCCACCGCCATATCGGCCGGAGTATGATCCGAGAGAG
CTCCGTCTCTGCCGCTGATCACCAGTTGAGACCCACTTGAAACAGGTGTGGTTGGCGCCGACCCGCTTGCCGATGTATCCAGAGCCGACATGAGCCAGGC
CACGCCACTGAAAAAGCTGGAACTGCTTTGCGTGCGGTTAGCATCCTTGAGCCTTTGGGCCTCCCGACGTTCGAGATCTTCTCGATTCGTTCGAACAAGC
TCCAAGAGCTCTATACTTTCATCCACCGTGATGAGAATGTCGCTCGATCCAAACGCACCATGAAGGAATCGATCTGGGAGAGCACCAAACTCGCGCAAGC
CACCGATCGCATGGAAAAAGTGCTTCCAACTCTCCTTGTGGATTGATTTGCTGCACGTGTTGACGATCTTGAGCATTGCTGCCGTCGCGACGGGAGCACT
TTGGTTATGGCAGTACATTGCCACACCGTTGACTTGTCCATTGTACGCTATCGGATACAGATCGGAGACGTACAGTCCAGTAAACTTGGTCACAGAGACG
AAGAACTCGTTGAAATCGTTGACGAGATCATGTGAGGAAGCGGTTGCCGCACACAAAACGAACCCGTTACACGCAAGCTGGAGCATCCCCTTATCGGGCA
AGTAGATATCCTCCGGCAAGTCGTTGTTGCGTGCGTCGACGGCACCAGATAAAGACTTCTCCGATAACCCGCCATTCGGCCCGTTGGCCACGTCGATGAA
CTGCTGGAACACGCTCGAGAAAGCGCGCTTCAACTGCGTCTGCATAATGTTGAAAATGTCCCGATCATAGTGATGGCCCGTATCATACTGGTTTGATGTA
CCGTTTTCACCCGCCTGGTCGTCGTCTGCTGCAAATGACAGACTTTCAAGAGATGAGGTCGATTTCACTTTTCGGCTCTTGAACTCTCGACGTCGCGGAG
AATCCTCGCGCGATGCGTGGCGTTGTGGTGAGCTGCTTCGGCTGCCATTCTGGTGTACAGTTCGCGACGTCAAGGTCGCTCTAGAGACCGGGCGGTGGAC
AACAAGTCGAGACCCCACCGGGTCGTGTTCTGCCTGGTAGAGCAAATCCTTCCATCGGTCGGTGGTCACTTCGCCGTGCTTGCTGTCGTCCTCACGAGTC
TTGATCTCTTCCTTTGCGATAGCATCGTACAATTCCGTCATGAAATCATCGGGCAGATCGCGATTCCTGGACACTTCTTCGCCATAGTTGCGATTGTTCT
TGATAAAGTC