Description :
From Genome Similarity Track
Location :
scaffold_333:291- 4623
Transcript NameFunction/comments
g7369.t1 hypothetical protein PHYSODRAFT_285052
g7370.t1hypothetical protein

Sequence
4332 bases(100 bases per row)
GCTACACGGATATCATCCAGCGCTCGTGAATTCGGTTCACCATACTGAGACAGAGAAAACTTCATCAAGTCTTGCTGGAAGTGCGTCGTGCCCTGGCCCC
TTCCCCGGTTTGTGGCTGCCGACGTTGCCAATAGATTGCGCGATGTATTGACAAGATTGTCACTAAAGAACTCCACCACGTCGCCTTTTTCTTCGTCGTC
TTTAAAGGTGGTGAATTGGCAAAACATCGCAGCTGTCTGGCAATCAGCAATATGATCCACTTCGTCGCTTAACGCACGGGTCGAAGTCCTTCTTCCTGGA
TTATATCGGTCACGATTGTTATCACGCTTCCTCAGCGTTTCCAGCATTTGATCGCGAAGGCCGTCCTGGCGAAACATTTGGGGGTCGCAATAGTTGGCGC
GCTTGTCATGCTGCGCCATGCAAAATGGATAGTTCGGATCAGTCGCACGGCGATAGCACTTGAAGCCATCGCTGACTTTGAACCCCTCGCACACAGTCTC
ATCTGGAGTTGCCCAGTCTTTGTGATTTTCACAAAAAAACCCACGTCCACCCCTAGTGATGGAACCCAAGCACCTTTTTTCATTCCAAGTAATGGCCCGG
CACTTCCCCTCCTGCATTGTGTTTATGGCAGAAATCTTGTCCCTGGCGAATTCGATGCACTTTACACTGCTTTCTTTTCGACTTGGCATACCCTTGACAC
CCAGACGACCTCGTTGGCCAGAACACATGCGGATGTGTGTCGAGATCACTCATTTTCTTTGTCGATGGATGAAGTGCCGAGCGGAGAACACGAGGTGGTT
GTAGTCCGCTGCTCTGAGAAAATCAGGCAATGGGCTGGATCATGAAAAGTTCTGGGGAGATAGATCCCTCTTGTGGGTTATTACCGGGGGCAATGAAAAT
GTCCACCCTCACGAAAGGCGTCAATGTCGCCTATCCGAACAGGAGTAATAATGCTGGAGAATCAACCAGCTATCGCCTAGCAACCCGAGGGCACTAAAAC
GACACTAAATCATAATCTACGTTTCTTGTCTACAAAATGCTGGATGTCGATCTTGATCCAGGAAATGAGGTAGAGTCAGGAGCAGGATGTTCTTGGACGC
ATTCTGGTCGCGATTCACAGTCATACCAAAACAGCCATTGTGTTGACAATGGAGTACACTGTGAACCTTGACGCGACGAACGACGCCGTCCTTGCACTTG
CGTAACGCAAACTGATACGTTAGTTCTCGATGACAGCCTGCATGTAGCTTGCTCGTGCGAAACTCGGGAACTGAGTCGACCGTGCAGTAACGCTTCAACT
CGTTCTCCAACTTTTTGACTGGGCCTGCCGGACACTTTTTGATCAGGCCTCCGTAGTCGGTCGCGCTCCAGTCTCCAAATCCAATGAGAGTGTTCGCTCC
AGCTCTCGTTGTCAGCTTCTGACATAGTTCACGAAGCTTCTTTTTCATGAAGATGTAGCGTCTGAATTTGAGCTTTCGGAACGGCTTCGCCATACGAAAG
TCGAGTAAGCGGTCAAGTCGCGGAATCAAGAACCGCACATACGTCTCCAATGTCTGAAGAGAGCATGTCTTGGGTGACGGCATGTTGCGGATCGCATCCA
AAATCTTTGGATCATGATCAATCCAGTAGCGAGTTGTCTTGTTACTTGACTTGTACTTTGCGTCTTCATAGAACTCTCGACTTGAACACGAGATCGTCTG
ACCAAAGTTGTTTGTCGCCACAAAGAGATCACGCCGACCGGGATCCAAACCCCACACTTCGCCGAAGTCGTACATCTTGGGATCTTTCTTCGTTGGCTTC
GATAACTTTTTGCTTTCTTTGGCTTCCGTAACACGATACTAATTGCTTTCCCGTCTGTCAAGATCTCGCCTGCAAACTTGCGGTTCGTCGTTTCAAACTT
TTTGATCTTGAACAGCTTGCGCCACCATTCGTCCACGACGTCGTTCCAGACTAGTCCTTCCTTTGCTTGACGTGGTGGAATCTGGATTCCAGCTCGTTTC
AAAAGAGCATAAAGACCGAGCTTGCACATCTTGAAGTGAGAGCACTCGAACCCACGCTTGATTGGGAGGAGACTGAATGATCTCAGTTGTTGAAATTCAG
GATCCTTGCGATGACTGTCGTTCTCTTCTTCAATGAACTGAAGAAAGCGATATGTCTGGTAGAATCAAGTGCGGGTTGTCCTTGTCGATAAAGCCATCCT
TGTTGCGAGGAATCCAGCTACGAAACTTCTTCACGCGTTCGTCACTGTCTTCGTACGTTGGTGCCAATACGTCTCTCAGCAGTTCGTAGCACTCCTTTCC
AGTGATTCCAAATCGCTGCTTGACGTACTTCTGGAACCGACGGTAAAAGTTCACAACAATGTGGTTGGAAGCGTTCGTTGCCATTTGCAAGCTTGCGTTC
TGGAACCATCCGACACTGATGTGAGCACTGCTGGCGAACGGCACGTCAGGATCACGCCACGACTTGTACAGTTCAACAGACTGCCATAGATCTTCGTCGT
CGATCTTCTTCCGAGTCTTCAAGCCCACGCTCACGGCTGACAAACACTTGTTGTAGAAATCTTGATCCAAAATCGGAATTGGTCGACCAGCTTGACACAG
ACGGAGAACGCGTAAGTTTGCAAGGAGATACGCTTCCGCGACTGCCTTATTCGTGTCCTTCAGTACGCTCTCCCATGGTAACGCACGCGCGCTCTCATTG
CAAAACGACTTGAACGAACACTTGACAATAGTGCATTCAGTATTTGCGTTTCGCGCTTTTCGTTCACGAACGTCTGGACGCTGGCGTTTGGTCTTCACTT
TGTCAGGTGGGTCGATTTTCTTCTTGCGCTTGCCACTCATGGTGGAAAATCCAAAATGAGAGGATGACAGGAAGCCGAAAATACCCTTCTTCATTTCTGT
ATGATGAAAGGCATTTCATGAACATAGAATGGGAGATTATTGCTGTACAAACGCGCGAGTGAAGGTCTTCAAAATTTCTTGGTGAGGACACATGGATTCG
AAACTCATTGTTTGCAAATGCACAAAAAATAAAGTGGACATTTTCAGTGCCCTCCGGAGTTAACTCGAAGTCTGCAGTCCCTGCGTCGACACAGATAAAC
ACGAAAACGAAGACTCTCGACGCGTCTGCTAAACCATTTACACCCCATCCAGTGCGAAGTAACGGCTCACCACAGCAGAATGACCGCAGCACTGCAACCA
ACGTGCTTGTGTCAAGTCCAGCTGCAAGACAGCAGCACATCGATTCCGGTACCGCCTGCGCAAACGGATCCGCTTTACGTCTCGCAAGGCGACTCGCGTC
GTGAACGACATGCACCAAAAGCTCTCCAGCTGGCTGACCTCGAGATACCAGAACGTCCTCTTGCCGTCGTTCCAGACGTCCGAGATGGTGCGCAGGTATT
TCTTAGAGGTGGCATCGGACGCTACCCCAGAGACCTCCGCCACCGTCCAAAAAAGAAAGATCAGGAGCCCGACCGCGAGAGCTATGATGGCGCTGGCACA
CTACAAGTTCAAGATGCTACTGAAGTACAAGATGGAGTGCGCCGGCGGGCGCGTAATCGACTGCGAGGAAGAGTACACCTCGAAGACTTGCTCCAGCTGC
GGCGAGATCAAGAACAACCTTGGCGGGAGCGACGTGTTTCGGTGTTCGTTCTGCCATGCGAGATACGACCGCGACGTGAACGCCGCGAGGAACATCTTCC
ACAAGAATATGGCATTGATTCCATAGTGTCCCTAGATCTTTTACCGGCGAAGCCTTCGTCGCGGAGTCCTGTTCGCCAGGGATTTCATCTCTGGTGGATG
TTAAAGGCCCACGAGTGCCCAACCTGCTAACTCTCTGTAAAGTTGGCAAAACGTGGTAACTCCCAAGGCGACAACTCAGGGAAGATTTTCCGTTTTTTGT
TTGGGTCGAGCCGAAGCCTAGCACCTCGGAGTAGGTTTCTCCGACTGCTGGACCCGAAGAGTCCAGGCGAGTAAGTGCTCGTTCATCATATAGATGTTGC
GAGCGGCGTTCACGTCTCGGTCGAGAACGTGATTGCAATGCGGACACGTAAACGTCTTCTGCCGATTGATGTTGTAGTTGATTCTCCCACACTTCGAGCA
GGTCTTCGACGTAAATGGCTCGGTACACTCAATCATACGTCCGCCAGTCCTTTCCATCTTGTCCGCTAGCATGACCTTGAACTTGTAGTGAGACCACGTG
AGCATTGCCCGAGAGGTCTTACTGCTGATCCGTTTTTGTTTCTGGGTCATTTCAGAGGTCGCGAACTTTGGTAGGAGGACTTCATCGTAGTTGCTCGAGA
GCCACTTAGAGCACTTTTGATGCATGTCCTTG