Description :
From Genome Similarity Track
Location :
Scaffold_3888:291- 1857
Sequence
1566 bases(100 bases per row)
CTGACAAACTGTCTGAACCGCATGCTTACACCGGAGCACGACACGCCTCCTTGCACACAGGCACTGATTACATGGCAGCACATAGCATGCTTCCTGTTGT
AGGCGCACGAGCAAGACTTGCTCCTTGTATCTACGACCCAACTACCTGCAGGCATACCTTCGGTTTGTTTTCGCCTAGAATTGACCGATCTGATTGATCT
AGCAACAAGTTTCTTTTCGGAAGCCGCCAGCCGCAATGGGCGCTGCTCTACACGATACAGATCGGCTGCTACAGATCCTACTGGAGGTAGGATATGCACC
ACGAGGCATTCTCTCTTGCACATAAGGCGATAAAGCCTTACCAGGCGCTCTGAAGCAGTAGGGACTGACGAAAACTCCGGGTCCGAACTCATAAAAGCCA
GTCTGGCACCATTCAGGTTTTGTATGAGCTCACTAGGTATGGAAGGTCCATCAGGACATTGTAGCTTGACTTTGCGGTGATACTGCTCCAATGCATTATT
GGTAGCCGCATATCCGGGTGGTGTGTGATGAGCCTGCCAGCGCATAAAACGGTGCAATTTGACCCACATTTTAGCAATGTGATCAGTTACTTTGCGTACT
GGTGATCCCCGGGGTTTTGCACTGCATTATGTTCAGATTTGGTTTTCACCAACTGGGGTACTCTTTCCTACTAGCATAGTGCATATCATAAAGATCCCAC
ATATACAGATCTTGTGTCACCTTCGCTGACGCGCTTTTCACGAGAATGCTTCCATACATTCTTTGTCACATGAAACCAGCACATTAAGACAACAGTGTGT
GGTAGTTCTGTGACACAAGCGTTAAATTGTGCTTTGTCAGCATCCATCATTACAAATTGTGGTGCAAATTGAACACCAGCACAGTCCATGCACACACGCT
TCAGGTATCTGATGCACCATCCGATGTCTATCGCACGTTTTTGCGAAGTGCAAAAGTATACCAACGGAAAAAAGTGCCCAGCGCGATCCGAAAATCCAAA
AACAAAAACCAAGTAGCCGTTTATAACCATGCTGTGCGTACTGTCAATGTGCAAAATTGTAGTGAAATCGGGATGAGTCTGGACCGCAAGGTAGCTTCGA
ATTAGACGTAAACAGGTCATCCCTACCCGAAGAGGGTACGCGACCGATCCGTCACCAAGGTGCGAAACAGTCCCCTCTGCACCGGGCCCCGTGTCGCGTT
GAGAATCACATAAAATGATCATTGCTGTGTCTGATGTCGTCTCTATATCAATTTGGTCATAGAGGTGACCATCACACAGCTCTATCATCGGCGCCATAGA
ATCTTTAGGATTCTTGCGTCTCCAGTTCTTAGCGAAATCTGATACTTGTGAGCTAGTAGGAGCTGGACCATCGAAATTATTCTGGTCAACCAGTGTACAG
ATAAGCGAATGTAGACGTGAAGCCGTAGTTTGCTCTCCAGCTCCGAGGCTGTCCGTAATGTAATCTTTCATTTGCAGAGTAAGCTTGCTCTTTACTGGTG
TTGGGGGATCATCGGTGCCCATCGCATGATTGCCTTGTTGAAGCACCTCACACGTGCTAGATGACA