Description :
From Genome Similarity Track
Location :
contig_51:29099- 30920
Sequence
1821 bases(100 bases per row)
TACTTCGGATGCCGCCGGAGAGATTGCGCCCTTGCGCTTCTGGTGGTAGCACTTCGAATGAAAGATTGAACAATGGACGTGGTTCACATCTAGTAATGTG
ACATATGGCTCTTCAGGTTCATACTCAGGAAGCCGCGGCAGTTGCTTATAGCGTTTAGCAAATGCTTCTGTATCCGCGTTTGCCTCTGCTCCGATTTGTA
CTTTTGGAGTAAACACCGGAGTAGACTGAGCCGAAGTAGACACTCTAGTCGGAGCAAACTTAGCTGAAGTAGACCTCGGCGAGTAGACCTCGGCGGAACA
GACTTGGCCGAAGTAGACCTCGGCGGAGCAAGTGCTCTTCTCGGCGACACTTGCTCGCGAATGCTTCAACATCAGTAGTAGTATCATCAATACTACTTTG
ATAGAATACGATTGCTTTCACGTCTGGACGGCGGACGCACTTCCAAGAAGAAACTCCTCGTTCAGAGTTGAATATCAAGAAGAGTGTATTGTCATTGTCA
TGAACTCGATCGCACATTGAACACATGCTGGGCGCATATCGTTTGACATACATTGTTGACTTGCGAAGTATAGACGTTGAGATGTCCCATGCGCGATCGG
AGTAGTCGCTTCTGTTGTTAACATGCTTCAGCACTTCTTCTACAAACGCGGGACCAGCTGCTTCGCCTGGGTACGCAACATCGTTGATGATGTTATACTC
TGATAGATCCACATCATCAATGGTGAAGATATCATCAATCGTTACGAAGTAGTGTTGACCAGCAGTGCTGTAGTCATGATCGATCCAATTAGTTGAATCA
CCATGCGCGCATTGCTTGGTGCCGAATGGTAAGCTAAGTGATCCGTTGCGATGATACTGAGTTGCATCGATTGAATCAATCAAGAGATCAACAATGTCAT
CGTCGATCATGAGTACCTCCGTGTTGTCTCTGATCACACTAGTTTTGATATGATCAACAACTGCGGCACACGCTTTGAGCGACAGCATCAGGTTTGTAAC
AATATGAATGCTGATCTTGTATCCATCATTCGCTAATGGGCGATTGCGCAGTGTTGATAACCAATCGAAGCGAGACAGAGAAGAGTCTTTAGAATCAATG
TCAACACCATGCTCTTCAAGCGATATCAGCGTTGCCTCTTTGAACGCGATTGCTAGTTGCTTCCCAATTGTCTCCATTACATACGCTTCGTTGTCAGTAG
AGAGTTCGATGTTGATGCTTTCGGCTAATTCACTTTTCTGAAACTCATTTAGTTTCAAGTCAGTATCAAAGAACATGCGGCAACGCGGAGTGATGATCAG
TTCATGAGCTTCCATCTTCAAGTTCAGTCCTACGAACTGATTGAACTTCAATGCATCTTGAATGCTGTACAGCCAGTAGAACGCTCTGCGTTTGGATCGA
GTCTCTACTCGCAGTACTAGCATGCTACGCTGGATCGGGTGCATGTAGTTTTCGGTTTTTGGATCTTTGAGGCGGAACGTTTCATGCCAGTTCCCGGTTG
CGTTTGATTCAAGGTTGGCATGACACTCGGAGATGATAGGCATCGTGTATATTAGGTTATGACAATTGCGATTTTGTGATAACCCCAAAAAAAGCTAAAA
TAGCATCTAGACACGTTCGAAGATCATGTATCCATAAAGTGATACATACTCACGATCTTCCGTTGTCATTGAGTTGTAGCCTCTCGCGTTTTGTTTCTTG
TACGAGCGCAAGAGAGATCCAAAGCCGTCCGTCTTCACTAGTTTGAAGTGATTCGCCTCAAACACCTTTTGAACATAATCATAGTTCACCAGGTACTCGC
GATAGTACATAGCTCCACTGA