Description :
From Genome Similarity Track
Location :
contig_5:290987- 293924
Transcript NameFunction/comments
g1340.t1hypothetical protein AM588_10010943

Sequence
2937 bases(100 bases per row)
TCTCCTTCAGGGTGCTCATAGTCGTCAAAGCCTAGTACCTTGTCCGCAAAACTGAGTGCCGTGTATTGCGAACCCATAACCAGACCGCCTGCACCCGTTA
CAAGCAGTGCAGCTAAGCAGCTACGCAACTCTTCTTCGCTCATATGCTCACCGGAGTGCAGTAGCCGGGCTTCGAGCTGGTCCCATTGTAGTGTTGCTGG
CCCATCGACCACATTGTCACCAATCGCGTTTGAGCTTCTCGACACGGAAGCAAGTATCTTGAAAGCGCGCTCGATCTGTGCCTTGCCAACTCCGAATACT
GGTCGATGGTTAACGTACAGCTTGATGAAGTCATGCAGCCCGATACTTTCAACCGGCCGAGACGTCTCGGTAAAACGTGAATAGCGAACTTCGCTCACCA
TGTGCTGGATCTCTTCGTCTGTGGGGTAATAGCCCAGCGCACGCATGGCGTTTGGTATCTCACGCAGCGGAATTTGAGCAGTGATCTCGCGGGCAGCGGT
GGCATCCTCGCCTTGGACACGAAGCTGGGCCAAGTAGAAGTAGTCGATTATCTCATGGTAAAATGACCCCTCACGGCCACCTTCCAGCAGTGCCAGGTAT
GGTGCTAGAGCCACATCGTCTTCGCCCAGCTCGTTCTTTGCTGAAGTACGTGTATCTTCATCACCAAGGTCATCCCCAACTGCTCCTCAATACTGCGAGG
AGTGCCCCGAGCCTCCAGTAGGTCTAACTGATGAGTGTGAATTTCCCACATATTCACCACAAGATCATCCCCACCGGCAGTGAGCAAGTGACTCCCATCA
AAGGTGACATCGACGTTGCTGATTTTGCCTGGATGGGCAATGAGCCCCATGGCCTTGTGCGGATTGCCATCGAGAGGGAGCTTTAGCAGTCCGACAACCT
TTTCGTGCGTACTGTAGACACAGTACCGCTCCGCTACGCCACCGGTAGCCTCAGCAGCTATTTGGTCATCCTCTCGAAGCGGTACAGGAACCAATCTGTT
GATAGGTCCACCGTATGAAGGACCTAGTGTTGTCTTCCGGCACGTCTGGTTGCCTGTATTCCACTGCTTCAGCTTGTACTCATCGTTAACCACGATAACC
AAGTCCTCTTGCACACCACGCAGCTCGGGGTGCCAACAGCACGCAGTCGGTACAGCACTTTGCTCTACACGTGTTGGGGCATTCTTGAGAACGACACCAT
CCAGGATACTTGACCGCTCCAGGCAGTACTCAGCTAAGGTGCGATCTTCACTTACGGATACCAACACGGGTTGCCCGTCGCCATCCCTCGAGAACTCGAG
TCCAGTTACGGGCTTTGAGTGAGCTCGGCAGCGGCCCAAGTATACCCATTCATCAGCGTCGTCAGAGCCATCGGGGTTAGATGTAACTTGCTTGGCGCGC
CACATACCGAGAAACAAGTTGGCGTCTAGTGCCACGAAGAGCGATGAATCAGGACTAACTAACACATCCGTGATAGCAGCTTTTCCAAGCGGAACGAAGC
TAGATCATCGAGCCGATGTCCATGCAGCACTTTCACGATACCGCTGGTGAAGCCAACTACGAGCTTTCGGCCATCGCGAGCAAATGTGAGGCACTGCGGA
CGGAGCTTCTCTGATTCAAAGCGTCGTACCATGATGAGCCTCTTAGCCGCGTAGTCCCACAGCTGCACCACCCCCGAGTAGGAGCTGAGAGCAAGCTGAG
GAAGTCTTGGATGCGCAGCAAGTCCATGAATGGAGTCGTTGATCCCCTGCATGAGCAGTGTACCTCGTCGCCGCTCAGGCTCATGCTCAGCAAATAGCCC
CGCACTCATACCAACGATGAAAGCCGAGGCTGTAGATACAATAAACTCAGGAACGTGGAAGGACTCGCTGTCTGCATCGTCCCCACCTGCACGACCGAGG
TTGCTGTCAGCATCGCCATTAGTTGCATTCGCAGGAAGAGCAAACGACACACTTGTGACCGGACCAGCATTCATGTCTTCAAACCAGGCCACCAAACGGA
AGTCGAAGTCATAAAAGCGAACAGCACCATCACTCGAGCCAATAACAAGATAGCCGTCCATATCTACGAGAGCAGTTAATGCTACCTTGCGCTGTGGCTC
AGCACCACCCGCGAGCCGCACAATTTTGACCGCCTTTCGCTCAGGAAAACTCCCTGCGGGAGTCTCAGCACCATTATCGCTTTGAACGGCATCCCAAAGC
ACGAGATCGCCGTCTTCTGTTCCAGTGAGTGCTTGCGCAGAGTCTGGCACAAACAGTGACTGCGTGAAGGCCCCCACCACCTGGCGAAAATCTTTCTGCG
CCAGCGACGGAGAGTAGAAGAGCAACGTGCGCGCTGCCCAGCTCCAAAAGATCACTCGCTGACGGCCTGTCGTGACTAGTTCTCGAACGTCGTACGTGTT
GAAGCGCACAGCGTGCTGCACGTCTTCTGTGGCTACAAGTGACGAGTACAAAGGCTTTGATACTGCTGCCCCGCTGCTGGGGCGGCCCACTCCCAGACTG
CCAGCTCTTGATCAAATCGCTTTCGCGCTGTATTCTTTGCCTCTGTAGTCTCACGTCCGTTTTCATCTTCACGGTTGACAGCACTCAGCGTAACCAGGAA
GAGCGCGTCGGGCGAGATGTCAATAGCTTGGACGCCGTTCGCGTGTGGTCGAAATATGGTTCGAATCGGGTTACCCGACTGAGCGTCCCAAACGACTAGC
ATCGACTCGTGACCGCGGTCAGCCGTGACAACCCATCGCTTATCCTCACTGACAACGCAACAAGATATGGGGTGGCAATGACCTTGTAGAAGTCGTTGCT
GACGGCGGGCATAGTCGTAAATGACACCGGTGTGAGCAGCCGCATAGAACAGCACGACGCGAGCCTGCCGATAGACTGTGCACGCCGTTGATCAAATCCT
TCTGAAAGCCGAAAGTCCAAGCCAATCGCAGTGCGTT