Description :
From Genome Similarity Track
Location :
scaffold_55:29098- 33864
Transcript NameFunction/comments
Pl_110964hypothetical protein PHYSODRAFT_468098

Sequence
4766 bases(100 bases per row)
CCATTGCAGTGGTCTTGAAGTTGACCATTGGACTAAAGGCTTTGCATCCTATCATGATGTATACAATGGGTCGTCGTCGATCACCACCGACCACACGATT
ATTTGTACTCCTAGCGTTCACGAGATCAACGATGTTGCTCAAGAATTAACATTTTCTGGCCATTATACAGAAACGATGGCCGTACAAGCTTCTAACGAGG
TACAAAGTGTTGTTATTTTATTTCTACTGATAGATTTCTATCAAGAAACGATAGCATTGCTGATTTTATAGCCCGCCACCCATTCGTGAACTTAATTGAT
GATCTTTTTGCCAAGATAAAGCGATTTTAAATGACTGATGAAATGGAACACAGCAAAGTGTATTTTATCACGTTTGCTCTGAAGTGTAGATGCGTTTCAC
TAATCACCCAGAACGCAAGTCACGTCACAACTGCTTAGAAAATATCGCCCCAACAAACACAACCACATTTTGCGAGACTGACCATTTTGCCCGCAAATCT
AGGGAATTGCGCTTGCATTTGCTTGGTATCCCACTCAACGGGTCAGTGACAAGCTTACTACCGCCTTCCCCGGCATCAACATTAACTACTGATGAGTGTT
TACCAGTCACTATGAATTCAGTTCATGTCATTAAAAACAATTTTTTTGATAATCACTAACACCTATTGTTACCGCTGGATCGGAATGCCTTGCATCCTAT
CATGATGTATACTCTGGTGCCACTTCTCATCGTGGATCATGTTGAACTGCATCAACTATTATTTGTAAGCTACATGTATGTGTGATGAATCGTCTTTGAA
CCTTCCGAAAGCTACAGAGCAGCTTTGTGTGTATGTAGAATTTACTTGTAGTATCCTAGGTATGAGAGAATTATGTTTTGCCAATCGTGCATGAAAACGT
TGGTGTTGTATTGTAGCAGCTTCCAAATCCGCACCTATTGACACTAATCTAACATCATATCGGACAAACTCGATGTTCAGACATAACATACTTTCGGATT
TTGAATATGGATTTCCTAGCAACATGTTTTGTGTAATATTGAAGATGAACGTATTTTGAGAGCAAGAATCAATCCAAATGTATTTGAGTTCCATTAGTCG
AGAAAAAAGTGGAAACCCAATCATTATGAAGTTGCAATCTGCAGGCAAGACAGTGAGGTTCAAGCTCGAGACTCGTGAGAATCTCTAAGCTTTAGATTCC
TGGACAGGCGAGTGTTGGAGCAGGTAGTCATCGCCTTCGTTCTTCTTGTAGGTCATCAGCGACACACCCACAGTCACGGCCGGCGGGATAATGAGGGTCA
AGATAAAGGTGATCATGCTGTTCTGCGAGTACAACCCCTCGGGCAGGACGAACCAATTGAATCCACCCACGAATTTTCCCTGGGCAACCATACCGTAGAT
GAAAACCGTGATGAAACCAGCAACGTTGCCAGCCAATGCGCCTGCGCGAGTCGCTCGTTTCCACGTGCCAAGCAACATTGGACCAACAACAATCGTACAC
AGCAGGTCAGCGATCAGGTAGAGAGTCAAGATATCATACTGCTGGTAGCCGATCGCGATGGCTGGCGCATTTAGAAGGACTATATCACGCATAAACGAAG
ATGTGATTAGCAGGGTAAAATCAATAGAAACAGACGAGAGAAAGCTACTCACCGCAAATGATACGCGTTTGCAGCAACGAAAGCTTGGGGAAGCATGTTG
TGAGCTCAGCTGCGATACCCACTTGAAGTGAGTCGGAAACTCCGCTCGATAGCATGGCAATGACAATTATGATGAGAACTTGCCAACCACGACCCATGTC
GATCAGGATAGCAAAGAACAAGTCTCCATCCGGGTAAGCCAAGTACGACACCATACCGGCCATTGCGAGGATCACCGTGAACAGTGAGAGGATAACAGCG
GCACCAAATGCAGCCACGTGAACTGTGTGGTCATCGTAAGCGGCGTAAACACGTTGCCAGTAGCCTGTAGAGAAGAGATTGGATGCCGTCACGGCGATGA
CCAGTGTCACCAGTACCTCGAATCCCGCAGTCGTAAAGGCAGCCACATTAGTTCTCGACCATGCTCCGTCCGGAATGGACACATGAAAGAACATTGCGAC
ACACACAATAGTAACCAGTACAACCACAGCAGAACCCTGCCACACGTCCGTGGCCAGACTAGCACGAAGTCCACCAATGGTGAGATAGAGGTTCGTGAGG
AACGCCACCATTAAAATGGTGACGATCGGGTGTGCGCCAGGGGACATCATCGTCGTGAGTTGTGCAACGGACGTGTACTCTCCAGCGAGACAGATGAACT
GGTAGAACACCGAGATCGCTCCGATGTACAGACGCATGATGTAGCCAAACCGATTCGAGACCACGTCCGTCATCGTCACATTTTCACCCACTGCATTGCG
AATGTAGGGGCCGACAACAGCCAGCACAAACATGCCACTGATACCCGAGAGAGTGTATCCAATGACACCCCACGATCCAGCATCCACTCCAATCTGCGGG
AAGGTAAATAGCGCCCCAGCACCAATTCCAGCCGAGAAAAAGCACCACGCCAGACGTAGCGTTTTCGTTGAATTCCTAGCACTGTAGCAATAGTATAAGA
AATCCGTCTAGATCTTGTCAAGATAGGGCATGAAAGTACCTGACAAAGTTCTTGACCGAGCTGACGTCCATGTGCTGACTGACGATGATGGCGTACGTTG
CCACCGCTACAAGTGTAGCGGCCATCACGCCGTAGGTGACTCCATCTGCAAGCATCTTGACAACTTGACAGTAGATATTCACGTTATGGCCCAAATGTCC
TTAATTTTAGCTAAATTTTAACCTTACCACTGTTTTTCCTGAACGTGTCGACGGCAGCAAGAAGGAGAACATAGAGCGTCAAACAACAACATTCGCAGCA
GTCCCTCCGCCGGTGCGAACCGGATCAGGTTCTAAGGGTTTAATCTCAGCCGGTCAGCGCATGGAACTTGTCCATGACTGGCATCGGCACCCCTCGCTGA
TTGAGTGTCAGTGGAAAATAACTCACAAAGAGGACAAAATACAAAAGAGAGCGAAGAAATAGCGTAAAATACCGGAAGATGCGAAGCGACTTGAAACGAA
TTCGCAAATGAGACTTTGGAATGTCTGGACGCAGCGGTGGTGTGGACCACACTGTACGTCGCTGTTTACAATCGCATTTGGTTGGAAGCAGTGGGATAGA
GTAAAACGACTGTTGTCAGGTCATCGAAATAGATCGAATAGCGTATCATCGCTAGATCGAATAGCGTATCATCATCTCTAACGGATCTCTCGCTCTTACA
TTAGTCGTAGCATCTTTTTGATTTCCTTGTCCTCACTCATCCGCTGTCTCTGGCCTGTTATCCGACTACGCTCTGCTTTATCAGCTTGAGCACAACGAAG
TAGTCGGACAGCATCCATTTCCCGCTTCTCGTGGCGATTCCGAACAAACCAAAAACTTTTTGCATCACGTCGGCGTTCAAGCGCTTCAGCTTCACGGATC
TTCACAGCTGCAGCAAGTCGATTCTGCTCCTGTTCCTCTGCTTTCAGGCTGTTCGCGACGGCAGCCCGAGCTGCACGACGCATTAGCGCTCCAGACTGCG
CAACGAAACTTGATTCAAATTTTCGCGTGAGTTTGCGGCGTCGTGTGGCGTATCGTTGTTGCTCAAATACCTCTCGCTCGTAAACTTGATCTAGTTCGCG
CTCAAAACGCATGCGCTGTAGCTTGACGTCGATATCCAACTTTATGTTTGCCACCTCGGTCACTTTTTCACGCTGGAGCATGCGGCGATCCACGATCAGT
GCCTCCATTGCTCGTTCGTCCTCTTCACGCAGGTCACGAACATGATATTCTCGAGCCTGCTGCTCTTGGAGTTGTTTGTCCTCCACACACGCGTAACAGG
GTTTACCCAGTCGATTCACTAGCATTTGATGACGACTGCTTCCCAAAGGTGTAGATGGGGATGAAAATGACAGGGTCTGAGGTTGCACTGGTTGAGTCGA
CTCGAGTGGTACAATGGGGACTTGATCCTTCATTCGATCACTTCGATGTCGCTCGATATCTTTAGGAAGGGTAGATTCTACCACGTGCAAAGGCACAGGA
GACGAGCTGCTTCCGGACTGTGACACTGATTGAGGCGGTCTAGGGAACACGCGAGGAGGACCACGAGGCTCTGATGGACGTACGGGCTCTAGAGTGTGAG
GTTCTCTTGGTGGGATCTGTTGTACGTGGAAGTCAGGCGGCTTTGCTGTTTTCACGGCGGACTGAGATGTACCACGCGTCTTGAGAGGTGGATGGAGGAC
CTTAAGCTTGCGTTCCGTGTTCACCCACCAACGAGAAGGAAGCTCGTCTTGCAGCCACTCACAAGAGTCGTCGAGAATGACAGCACTCTCTTCTCGTGTA
GCAGCCTGACTCAATGCCCACTGACATAGCAACAATGCACAACTGATTAGCTTTACTCTGCACAGTAGCAATGATGCAGATGTACAGTATTAAAGCTTAC
CTGGTGATGGCGAAATGCAACGCCAAACAGAGCCTCCAACGAGAACATTCGCGCGTGTGTCCTCGTTACAGGGTCAAACGTCTTGCAAACGAGCAATAGT
GCCCGCTTCCGTGCCTCGTCAGTGGATTCAAATGTTAGTCGCACGAATGAAGTAGCCTCAATTCCTTGTTGTGACGGCTCTAGTTGCCAGTTTCTCGTTG
ACTTTTGCTCTGATAGCCGCCGAGCAAGATCCATCACGCGCGCGGCTGAATCGGCAACGCACTGGC