Description :
From Genome Similarity Track
Location :
contig_51:29098- 30919
Transcript NameFunction/comments
g10554.t1hypothetical protein

Sequence
1821 bases(100 bases per row)
TTCTGGTGGTAGCACTTCAAATGAACGATTGAACAATGGACGTGGTTCACATCTAGTAATGTGACATATGGCTCTTCAGGTTCATACTCAGGAAGCCGCG
GCAGCTGCTTATAGCGTTTAGCAAATGCTTCTGTATCCGCGTTTGCCTCTGCTCCGATTTGTACTTTTGGAGTAAACACCGGAGTAGACTGAGCCGAAGT
AGACACTCTAGTCGGAGCAAACTTAGCTGAAGTAGACCTCGGCGAGTAGACCTCGGCGGAACAGACTTAGCCGAAGTAGACCTCGGCGGAGCAAGTGCTC
TTCTCGGCGACACTTGCTCGCGAATGCTTCAACATCAGTAGTAGTATCATCAATACTACTTTGATAGAATACGATTGCTTTCACGTCTGGACGGCGGACG
CACTTCCAAGAAGAAACTCCTCGTTCAGAGTTGAATATCAAGAAGAGTGTATTGTCATTGTCATGAACTCGATCGCACATTGAACACATGCTGGGCGCAT
ATCGTTTGACATACATTGTTGACTTGCGAAGTATAGACGTTGAGGTGTCCCATGCGCGATCGGAGTAGTCGCTTATGTTGTTAACATGCTTCAGCACTTC
TTCTACAAACGCGGGATCAGCTGCTTCGCCTGAGTACGCAACATCGTTGATGATGTTATACTCTGATAGATCCACATCATCAATGGTGAAGATATCATCA
ATCGTTACGAAGTAGTGTTGACCAGCAGTGCTGTAGTCATGATCGATCCAATTAGTTGAATCACCATGCGCGCATTGCTTGGTGCCGAATGGTAAGCTAA
GTGATCCGTTGCGATGATACTGAGTTGCATCGATTGAATCAATCAAGAGATCAACAATGTCATCGTCGATCATGAGTACCTCCGTGTTGTCTCTGATCAC
ACTAGTTTTGATATGATCAACAACTGCAGCACACGCTTTGAGCGACAACATCAGGTTTGTAACAATATGAATGCTGATCTTGTATCCATCATTCGCTAAT
GGGCGATTGCGCAGTGTTGATAACCAATCGAAGCGAGACAGAGAAGAGTCTTTAGAATCAATGTCAACACCATGCTCTTCAAGCGATATCAGCGTTGCCT
CTTTGAACGCGATTGCTAGTTGCTTCCCAATTGTCTCCATCACATACGCTTCGTTGTCAGTAGAGAGTTCGATGTTGATGCTTTCGGCTAATTCACTTTT
CTGAAACTCATTTAGTTTCAAGTCAGTATCAAAGAACATGCGGCAACGCGGAGTGATGATCAGTTCATGAGCTTCCATCTTCAAGTTCAGTCCTACGAAC
TGATTGAACTTCAATGCATCTTGAATGCTGTACAGCCAGTAGAACGCTCTGCGTTTGGATCGAGTCTCTACTCGCAGTACTAGCATGCTACGCTGGATCG
GGTGCATGTAGTTTTCGGTTTTTGGATCTTTGAGGCGGAACGTTTCATGCCAGTTCCCGGTTGCGTTTGATTCAAGATAGGCATGACACTCGGAGATGAT
AGGCATCGTGTATATTAGGTTATGACAATTGCGATTTTGTGATAACCCAAAAAAAAGCTAAAATAGCATCTAGACACGTTCGAAGATCATGTATCCATAA
AGTGATACATACTCACGATCTTCCGCTGTCATTCAGTTGTAGCCTCTCGCGTTTTGTTTCTTGTACGAGCGCAAGAGAGATCCAAAGCCGTCCGTCTTCA
CTAGTTTGAAGTGATTCGCCTCAAACACCTTTTGAACATAATCATAGTTCACCAGGTACTCGCGATAGTACATAGCTCCACTGAACGGCAGTAGCACATC
AATGGCCTGATCGTTGTCCGT