Description :
From Genome Similarity Track
Location :
contig_83:29092- 31993
Transcript NameFunction/comments
g12779.t1hypothetical protein

Sequence
2901 bases(100 bases per row)
TCGTGGACAGCGACACACTTGACTGCTTCTTGCTTCCCCAGCTCACAGGCGCACTCATCAGCATGAACGTGTAGCCTGAGTGACTTGCGGTCCGCGAGGT
CGCCGGCCCAATCCGCGTCCGAGTAGCCACGAAAGTCGATGTTGTCGCCGGCTTGAAGCAGATGCCATGCGTCTTGGTGCCTTGCAGGTAGCGAAAGATG
CGCTTGACCGCAACCCAGTGTTCTCTTGGGGTTCTCCATGAAGCGCGACACATAGCCAACGGCGTACGCGATGTCCGGGCGCGTGGCGGTCATCAGGTGC
ATCAGCGCACCAACAGCTTCGCGAAACGGAGCGTTCACCTTGGTCGCCGCGTCGCTTGGAACCAGTCGAGTGCTCATGTCCACGGACTCACCACAGCCTT
GCACTCGTCCATGGCGAAGCGTTTCAGGATGTCGTCCACGTAGCGACGCTGGCACATGGTCACCGCTGCCGTCCGGCCGTCCACCAGCTCGATCCCAAGA
ACAACGCGCACTTGCCGCTGTCGGTCATCTCGAAGCGCGTCTTCAGGTCCGTCTTCGTGCGTGCGATCAGCTCGGGCGAACTCCCGGTAATCAGCACGTC
GTCCACGTACACCAGCACGAGCACGCAGTGACCGTTCACCACCTTGATGTAAGAGGCACGGATCGAAGGCCGACACTTGGAAGCCGATAGAGCACATGAA
CTCGTCGAAGGTCTCGTTCCACACGCGCGAAGTTTGCTTGAGACCGTAATGGCCTTCACCAGTTCCAGGCAGTCGAAGTCACCATCCAGTTCGACGCCTT
CGGGAACCACGCAGAACACCACCTCCTTCATGACCCCGTACAGGAACGCTGTCACGACGTCGAGTTGGTCGAGAGGCCAGCCGAAGTACTTGGCGATCGC
GATGATCATGCGCAGCGTCAAGTACTTGACCACGGGCGAGAACGTCTCCGTGTAGTCGATGCCGTACTTCTGCTTGAAGCCCTTGGCCACGAGGCGCGCC
TTGTACTTCTCGATCGAGCCGTCCGCTTTGCGCTTGATCTTGAACACCCACTTGGTGCCGATGGCGCGCTGGCCGCTGGGCAACTTGGCAGCTCGAAACA
CACCACGCAGTCGCATCGACTTGAGCTCCGCGCGGATCGCCTTGCGCCAGTGCACTTGATCCGGACCGTTCACAGCCTCTTGGAACGTCGTCGGCTCCGA
TAGATCGGCTGCTGCTTCACAGCGTTGGCACTGGCACGCCAAAACACTGGAGGCGTCGATCGTCGTCTTCATCTTGGTCCCCAGACTTTTCTTCTTCGTC
GGGTTCAGCTCGGCGCGACGAGGATACGTCCGGCGCACTTGCTTCTTCTAAGCCAGCCCGGTGGCGAACGAGGCGCGATCTTCTGGCAGTGTCGTCGTCG
CCACTCGGTCGGCTCTTGCGCTTCCCGCCTGCTTGAAGCTCGTTTGGCGCGGTCCATCGTTGCCGTCCAGGTCGAGCGCGTCCAGGTCCAGCGCAGCATC
ATCGACGTCTTCATCCGAAGTATGCGCCGAAAGTCCAAAGGCCGACTCATCGAAGTTGACATCGCGACTGACAACCACCTGCCCCGCCTCGATGTCATAA
AGTCGATACGCCTTGGACACTTCTTCGTAGCCGAGGAACAACCCGGCGCGAGCCTTGGGGTCCCACTTGCGCCGCTTTTCCTTCGGCGTCAGGATGTACG
TCTGGCATCCGAACACACGCATGTGCTTCACACTTGGCTTGGACTTGTACACGATCTCGAATGGAGTCTTGTGCTCCACCTTGGGTGACGGCAGGCGGTT
CTTCACGTAGATGGCCGTCATGGCCGCCTCAGCCCAGAAACACTTGTCCAACTTGGCGTGATGCAGCATGCTGCGGCCGATCGTGACGATGGTCCGGATG
GCGCGTTCTGCCGTGCCGTTGGTCTGGTGCGCGTACGGAACCGTGGTTTGCTGCTCGATGCCTTCGACTTCGTAGAAGGCCTTGAGCGAGTTGGTCGCGA
ACTCACGAGCTCCGTCGTGCCGCACAAACTTGACCTTCTTGCCGAACTGCGTCTGCACCTTCGTGACGTACGTCTTGATGCAGTCTTCGCTCTCCGACTT
GGCACGCAGGCAGAACCCCTTCATGCATCCGCTGGCTTCGTCCACGATCAGCAGCAGATACTTGCTGCCACCCAGTGACTCTTCTTCCATGGGGCCGCAG
ATGTCGAAGTGGAGCAGCTCGAACGTGTCGTAGCGACGCTTGTCACGGTTGCTTGGGAACGGCTTCTGGACCATTTTCCCTTGCTGGCAGCCGCGACACA
CGCTTGGTCCACTCGACTTGGAAGGTGCCTTCGCGTCCTTGATCATGTCGTTGTCGACCATCTTGCGAAGCACCTCCACCGGAGCGTGACCCATACGCGC
GTGCAGGTCGACCGTCTTCCCACTGGTCGCCGCATTCGCCGATCGCTGAGGCGTCTGGAGCCAGTAGAGGCCATCCACGAGGTTCGCCGCCGCCACCACT
TGCTTGGAGGCCTTGTGCGCAACGCGCATCTGGGTGCCGTCGAACACGACTTGGAACAGACCACTCTTGTTGATCTGTGGCACGGAGAGCAGATTCTTGC
TCATGCTCGGCACGTACAGCGCGTTCTTGATCTCGATGTCGCGCTCGTCGCCGTTGGGCAGAACCACTCGTTCCACGATGGTCCCCACACCCATGATGGC
CGCCTTGTTGCCGTCGGCCACCGAAAGTTCGCCCTCGTTTCGCTCAATCAAATGGGCGAACTTGGCCTTGTCGTTGCAGATGTGGTGCGTTGCGCCGCTG
TCGACCGCCCACATGCCGAGCATATCCTTGCCCGTCGAAATGCCACACTCCAGTGAGACCGCGAACGCCACTCGATCATAGCCGTAGCCGTAGTCGTAGC
T