Description :
From Genome Similarity Track
Location :
Scaffold_454:290889- 291979
Transcript NameFunction/comments
Aphin_H310_10602amylopullulanase
Aphin_H310_10603transposase

Sequence
1090 bases(100 bases per row)
ACCCCTGAGGAAAAGCAACGTGTGCTTGACGCCTACCTACGCGGCGACGATTGGAAGCTTGTTACCAAGCACAATGGTGTTTCCAAGGCTACGGCTTGGC
ATGTGACCGATACAGGACGGACGTCGTCGAAGCCGCGCGGCAGCTTTCGGCTAACTGAAGCCAAGGTAACTCCCGAAGTAAGAGCTGCGTTCGAGCGCTA
TTTGAACACTACCTGCCAATACACTCTGAGCGAAATCAAGTCGTTTGTTGCCGCCGATTTTGCTGGGTTGTTGCTGTCGATTCAGACAATCAGCAGTCAC
CTCCTCGGCATGCTATTCACCATCAAGTAAGTGCGCATCGAGCCCGTTACTTGCAACAACGCTATCAACAAGGAAAAGCGGCGTCAGTTCGTTCTTCAAC
TCAAGCAACATCAAAAAGACGGCGACTTTATCGTGTACTACGATGAAACCAACTTCAATCTCTACTGCAAGCGCGGTCGTGAGCGCTCCATCAAAGGGAC
ACGTGCGACAATCGTTCTGCCGCCGTCGAAAGGGCTAAACCTTCAAGTCCAGTGTGCTGTGTCGACTGAAATTGGCCTTGTCACGTACCGTATGGNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCCT
TGTCACGTACCGTATGGAGCGCGGCAGTATCAAGATGGATCAAAACGCGGCCTTCGTCGAGTCCATCTACCAAGCCGTCAAGGAAAGCGACGCATGGCAA
GCTGGCTTCGTCGACAAGCGTGTTGTCATCCTGTTCGACAACGCGCCAGTGCACTCGCAAACTGAGGAGCGTGTTGTCCAACACGACGACTTGACGCTCC
TTCGTCTCGGGCCGTACTCTCCTATGCTCATTCCGATTGAGAGCTGCTTCAGTGTTTTCAAGTCGCGAATCAAGGCTTATCTGGCGCATCATACTGCCGA
CATGTTTGACCGCGGTGAGTACAGTTCGTTTCTTGAAAGCCGGATGGTCTTGCTCGAGGACGCAGCTCGCGAATCGTTGCCTTGCATCAC