Description :
From Genome Similarity Track
Location :
contig_51:29086- 30908
Transcript NameFunction/comments
g8601.t1hypothetical protein

Sequence
1822 bases(100 bases per row)
TATAGCGTTTAGCAAATGCTTCTGTATCCGCGTTTGCCTCTGCTCCGATTTGTACTTTTGGAGTAAACACCGGAGTAGACTGAGCCGAAGTAGACACTCT
AGTCGGAGCAAACTTAGCTGAAGTAGACCTCGGCGAGTAGACCTCGGCGGAACAGACTTGGCCGAAGTAGACCTCGGCGGAGCAAGTGCTCTTCTCGGCG
ACACTTGCTCGCGAATGCTTCAACATCAGTAGTAGTATCATCAATACTACTTTGATAGAATACGATTGCTTTCACGTCTGGACGGCGGACGCACTTCCAA
GAAGAAACTCCTCGTTCAGAGTTGAATATCAAGAAGAGTGTATTGTCATTGTCATGAACTCGATCGCACATTGAACACATGCTGGGCGCATATCGTTTGA
CATACATTGTTGACTTGCGAAGTATAGACGTTGAGATGTCCCATGCGCGATCGGAGTAGTCGCTTCTGTTGTTAACATGCTTCAGCACTTCTTCTACAAA
CGCGGGACCAGCTGCTTCGCCTGGGTACGCAACATCGTTGATGATGTTATACTCTGATAGATCCACATCATCAATGGTGAAGATATCATCAATCGTTACG
AAGTAGTGTTGACCAGCAGTGCTGTAGTCATGATCGATCCAATTAGTTGAATCACCATGCGCGCATTGCTTGGTGCCGAATGGTAAGCTAAGTGATCCGT
TGCGATGATACTGAGTTGCATCGATTGAATCAATCAAGAGATCAACAATGTCATCGTCGATCATGAGTACCTCCGTGTTGTCTCTGATCACACTAGTTTT
GATATGATCAACAACTGCGCACACGCTTTGAGCGACAGCATCAGGTTTGTAACAATATGAATGCTGATCTTGTATCCATCATTCGCTAATGGGCGATTGC
GCAGTGTTGATAACCAATCGAAGCGAGACAGAGAAGAGTCTTTAGAATCAATGTCAACACCATGCTCTTCAAGCGATATCAGCGTTGCCTCTTTGAACGC
GATTGCTAGTTGCTTCCCAATTGTCTCCATTACATACGCTTCGTTGTCAGTAGAGAGTTCGATGTTGATGCTTTCGGCTAATTCACTTTTCTGAAACTCA
TTTAGTTTCAAGTCAGTATCAAAGAACATGCGGCAACGCGGAGTGATGATCAGTTCATGAGCTTCCATCTTCAAGTTCAGTCCTACGAACTGATTGAACT
TCAATGCATCTTGAATGCTGTACAGCCAGTAGAACGCTCTGCGTTTGGATCGAGTCTCTACTCGCAGTACTAGCATGCTACGCTGGATCGGGTGCATGTA
GTTTTCGGTTTTTGGATCTTTGAGGCGGAACGTTTCATGCCAGTTCCCGGTTGCGTTTGATTCAAGGTTGGCATGACACTCGGAGATGATAGGCATCGTG
TATATTAGGTTATGACAATTGCGATTTTGTGATAACCCAAAAAAAGCTAAAATAGCATCTAGACACGTTCGAAGATCATGTATCCATAAAGTGATACATA
CTCACGATCTTCCGTTGTCATTGAGTTGTAGCCTCTCGCGTTTTGTTTCTTGTACGAGCGCAAGAGAGATCCAAAGCCGTCCGTCTTCACTAGTTTGAAG
TGATTCGCCTCAAACACCTTTTGAACATAATCATAGTTCACCAGGTACTCGCGATAGTACATAGCTCCACTGAACGGCAGTAGCACATCAATGGCCTGAT
CGTTGTCCGTGAGTCGTCTGAGCTGAATGCCCTTTTGATTGAGTATTTGATTCTACCATTCTCATTGAGTGACCATTCCGGTGCAGCGGTCAGTAGCTTG
AATACATCTTCGCCGTTGTACG