Description :
From Genome Similarity Track
Location :
Scaffold_64:290609- 296969
Transcript NameFunction/comments
Phyci_94199conserved hypothetical protein
Phyci_94201Hypothetical protein
Phyci_94203inositol polyphosphate multikinase, putative

Sequence
6360 bases(100 bases per row)
GCGCCACGCCACGGCAGGGCGACATAAGGCGGCCGGGGCAATTCTCCGGGTCCCCATGTGCGCGCGACCATCCAAATGGCCGCCCGGCAGAAAAGGGAAT
TCGCGGCGGGGGCCTGCCCGCCCAAAGCCCCGTGCACCGTGCACGAGCCGAGCGGCGAGCCTCCGCAGAGCTCCAGAACAAGAGCGCGGCCACGGAGATG
GAGGCCTGCGCGGCGGTGCCGCACGCACACGCGCGAACGAATGCGGACCTCAAGCAAAGGTGTCCACCAGCATTGACGAGCGCGTGCACGAGGCGGACGC
CGCCGCCATCTACAGTACGGAAAGGTCCGCCATGCTGGCCATGCTGCGGCGCCAGCCCTTCTTTGCATTCCGGAGCTCGTCACCAAGATCGCGATAACGA
CAGCGGAGACCGCCGCCCAAGCAACTAAGGCTGCTTGGGTTGCTTCAAGAGGAGGCAATTTGCACACGATGATGGCCGCCGCCACCAAGCCCTGCCGACG
GCGGGGATTGCTAACCAGGGCCTGCCGCGCTCTCTGCGTCCTCCCCGCAATACGGACCGGCGGATCCCGGCCCCGATCCTACGAGCTGGCGCCGCCTTCA
CCCACCACAGCGTCGTGGCCGAGCGGGTCATCGACGAGCAGGTCCAGGAAACCAGGTGTGTCTGCCAGAGGCAGGCGCTCTGCGATACGCGAAGAGCCGG
GGCGCAGTCACCTCATCGCGGAGGAGCTGCTCGCCGCGGGCTGGGCTGTGCAGTTGTTGCCGCACTCACAGCGCGATGATGACTCGGAGCCGACAACGGG
CGCCGGCCGCAGCTACAGAAGCACTTGTAGCGCAATGCCCGCATGGCGCGAAGCTCACGGGCAGCACCCGGCAGGGGTCGGCGACCGAAATCGGCCATGC
GGCCGCGCCGCACTAATGAAATGCGGGCCTGGCCCGTGCACGGTTAATCCGCGGCCGCGCGGTTTCGTACGGCCATTGCCTTGACCGCTGGCTCTTCTCT
TCGTGAGCGGCGGCGCGCTTGCAATCCTGAAGTGCAAGGCCGGCCCCGCCACGCTCGCCGCGCTGCGCGTTTGAAATGGCCACAGCGCTCGACGAAAAAA
GCCGCGAGCTGGGGACAGCAATGTCGCCGCAGCGGCAGCCAGCCCCCCTctgcgctgcgctgcgccgcactgcactgcAGACAGCAGGCATCACGGCTGC
AGACAGCAACATTGACGAATGTGGTTTACGCAGGCGAAAAGGGCCAAACAGGCACCGAAAACGCTGGCCGGGCCGTAGAGCCTCTACTACAGGACCCAGC
GGTGCGGCCCCCGAACTGCAATCACCACGATCACGCTTGCTAGCGCGCTGCTTCAATAGCGGAGGCAGCGGTGCGTCCAAACGCGGGTGCAGGACGGCAG
GCGGCGCACATCGTGCAGGAGCCCGCTGCTGTTCTCGCGGAGCGAGCCGACGCGCACATACAGCGTCGCCGTTAAATCGCCCTGAACCCCGCGTTTGAAT
CCGGCCAATGGGCGGGCTTCGCGGGCTCTCGGAGCCCGCGCATTGGTTCATCACGCGCCTGCTCTCTCGTCATGCATCCGCCCAGAAACTGGGCTTTCAA
GGGGGATGGGCTTGGGACACGCGAGGGGATCGGTCTGCCAGCGTTGTACCTTTGCTACCGCGTCGCGCGCCGCCGATTGGATGGCCGGCGCCCCAGATGG
GAGCCCGGTTGATTTCTCGCGCTGTCTGCATTTAGCCAGCTAACTTTGGCTCGCTCCAGCAGTGGCTTCAGCAGAGGCGGCACCAGCGCTGGGGGTCTTG
ATCGCTCGGTGGGGAGCCCCCTCCTTTCGGCGCTAACCGCCATATCAGTTGACACGTGGCTCAAGAGAACGGGCAACCGGCTCCGTCCCGTCGTGAGCGC
CCTTCTCCGACCGGAACAGGCGGAGACTTTTTTGAGTGGGGCACTCACAACCGGACGCATTCAAATTCCGGTTGCAGCTGCTCCCCTAGCCCCGCGGCTG
CCCCTTCTTTCCCGCTCTGTGCAAGAACTCGAGGGGGGGGCCAAAGGGGGCCCGCCCGAGAGTGAGTGGTCGTCCTGCGCTTACCATTGTGTTTCCTACC
AGGCCGTTGGTACTCAGTCGCTCTCGCTGCCAGGTGCCCGTCTCCGCCAAGGGCCCAAGTATTTTTTCTGCCGGAGTCGGGGCAGTTAGTTTTATGGCCT
CCACGTCCGCGTCCTCGGCGTCCCAGTCCAGCAGCTCCGCCAACGCCATGCAGCCGCAAGATCCCGCCGCCGCCGCCGCGCTCGAGGCCTCCTCGGCCGC
CGCGCAGGCCTTCAGCTACGACCCGGCCGCCTACCAGCCGTACGGCCAGTCCATGGCCGGTTCCGCGTCCAAGCCCGCCGCCTCCGCCGCCCCCTCGCAG
TCCAAGACTGAGCCCGCCGCAGCGTCCAGCACGCGCGCCAAGACGGAGTCCTCGTCCGCCAGCACGTCCCCCACCAGCGTCGCCAAGGTCCAGAACCAGA
CCCCCGCCTCTGCTGGGGCCGCCAAgcccgccccggccgccgccgcgccggcccgAAACGAGTCGCTCAAGTCCAACCGcctctgcaccatgcccggctg
caccaagcgcgtgcgctccaagggcctgtgcaaggcacacggcggcggccgccgctgcATGGTCGACGGCTGCGAGCGCAGCAGCCAGGGCCAGGGCCTC
TGCATCCGCCACGGCGGCGGCAAGCGCTGCACGCAGCCCGGCTGCACCAAGGCGTCGCAGTCAAACGGCCTGTGCAAGGCCCACGGCGGTGGCCTGCGCT
GCCAGAGCCCCggctgcaccaagagcagccagggcggcggcttctgccgcgcgcacggcggcggccagcgatgcgagaaggagggctgcaacaagggcgc
ccagcgcggcggcttctgcgccggccacggcggcagccgcttctgccagcacccggactgcaccaagaacgaccgcggcggaggcttctgcgctgaacac
ggcggcggcaagcgctgcGACCACGCCGGCTGCAACAAGCCCGCGCGCAAGAAGGGCAAGTGCTCGTACCACGCCAACGCCGCCAAGGGCAAGCTCCCCA
AGGACCAGCTCGCCACGGCCGGAGTGCCCGGAGCTTCGCTGCCTCAGCACATGATGGATATGCGACAGATCACGACGCCGACGTTCGCAATGGGTGTCAA
GGATTTGCGCGACCCCCACGTCGCCGGCCAAGTGGACTCGCGCGCCGCGTACGTGCAGCAGCAGCGCGTGGAGATGGAGATGCGCTACAAGGGCTACGAA
GCGCCGAACGCCAGCCAGTACCTGCAGATCCACGCCGACCAGCGCTCGTACGAGCCCATTAGTCTGCAGGCCGGCGGCGCCGCGCGACACTACATGCCTG
TGGACAGCAACGCCCTGCCTCCTGTGTCTGGCAGCATGTACAAGCCGGCCGGCGCCATGGACCGCCAGGCGTACGCCCCGCGCACCGCCGAGCAGATGAA
GAATCCGTACACGCAGCACTGGGCAGCCAAGCCGGAGCTGCCGCAGCACCACCCGGACGGAAGGGTTGACTATTTCGAAGTGAACAAGGAGCAGCAGCAG
CAGGCGCAGCAGCAGCCGAACCACCACCTGCCGTACCCGGCGCAGTCTACGCAGTACCACCACCACCTTAGCGCCGCAGACTCCGCTGCCGCCGCTGCTG
CGGCTTACGGCCAGCAGCAGCAGGCTCCGCGGGGATACTACACTCAGCAGTCCGCGCAGGCTCCCGCATCCGGTGACCAGTCCGCGCCTcagcagcaaca
gcagcagcagcagcCCAACATGATGTATTACTCGGCCAACGGGTACCCGCAGCACCAGATGCACAACCTGCAGCAGCAACAGATGCAGATGTTATAAGTC
CAGCGATGCCGGAGTGCAGTCGCTGAACGGGTCTGCTTCCCTCTCGTCGCGCGATATGAGACCAAGGTGACGGACCGAGTGCAAGCGACTGGAAGCTGAC
TGCATTGCGCTGCAAGGCTGTAATAGAGATAGAAACAACCCGCTATGGATCGGAGCTCCTCGCACTCGAGGAAGCGGCAGAGAAGTGTTTTCGTGCCGTC
GGAGTTGGGAACGTAGTCTTCCTCCCTACCAGTTTTGACCTAGCTAAAGGAAGCAATGAGCAACAACTAGCATTATCCACATGACTTGTTTCGGCACGTT
CGTGTGCCTGCTGTAGGTGCTCTTGTCCTGTGTTCGATCACATGTACAGCGGCACCACCGACATCTTGGTGTCCTCATGGTGCAGAAGCCCGTCGGCGGC
ATTACCTTCCCCTTCTCTTGGGCGTGCAAGCCCGGACGCTCTCGGTGCAGGGGCTCAAACGTCCCGGAGGCCGAGAGGACGCAAGCGTTGGCGCGTCTGA
AGCGTACAGCTCTAGGTCACATTGCACAAGCTAACATTTGTCTAATAGTCGTACGAACGTCTGTACGGATACAGTATCCACAAGCTACGAGCTGCTCCGA
CTGTACTCCGTCGGCGTGGACGCTCGTCGCGCGAGCAGCGCGGCCTCGTCCTCGTCGTCCTCGTAGCTGCTGCTGCTGAGTTCGCCCGCCTCGTGTTGTA
GCCTGGCTGTGAAGCTGGTggcccgccgtcggggcgccacggccgcggggcggcATCTACTGGGGCTGTTTGTTGCTACGGCGGCCGTGGGGCCCCGCAC
GTCCTCCAGCTTGGCGTTGCGGGCCGCGTCGCCGCGCCGCGACTGCAGCTTGGCCTGCAGGTACGTGCCAATGGCCGACGTGGGCAGGTGCAGCGGCCCG
GGGGACGAGACCCGCGGCGAGCCGGCCTCCTGGTTGTCGTCCAGCGCCACGCGAAAGCTGCCCTTGCCGGCGTAGTAGTGGCGGTAGCACTCGACGAGCT
CGTGCTCCATGCCCGCGTACGTCTCCAGAAGCTGCGCGGCCGACGCCTCGTTGCCCGGCTCATAGACGCGCAGCAGCCGCGTGAGCTCCGACCGGTAGTC
GCTCGAGTCGCGCTGGTTGTCGCCTCGGCTCGGGCTGCTCTGCTTCTGCGGACGCATGCTCAACTCAATTGGGGCTAGTGCTACTGCTGCCGGAGATCTT
GACAAAGTGGAAATGGACGCTGCTCAGGTTCGAATAGCCCCGACCAATTCTATATAATTTTTTTTTCTCGAAAACGGTTTTTTCCACGACTTTCGACTTC
AACTAGACCCCCTGCTGCAGGTTACACCCCTTCGAGGCTTCTCATCTGTGCGGCTGGTCATGAGGTCATGCGGATCTTCAGTGCTGGGCCTGGGCTTCGC
GCAGCAAGGTCTGGAAGCACTGGATGAGAGTGGCGATGCCGGTCCGAAGCCCCTCGTCCCGCTGGGGAGGAGCGGGCGTGGTGACGTGGGCGAAGTCGAT
GAGCCGGATGTCGGCTGCGTGCGAGTCGGGCCCGGGCTCGCCGTCGTACAGGAACAGGAAGGAGCTGGCGATGAACTCCGTGCCTTGCTGCTCGTCGAAC
CACGTCCTGAATTGATCCAGACGCCGCAGAAACTGAATGGAATGTGCATTACCAACCAGCACAAGAGCGTCAATACCGCGATATCATCTCCACCGACACT
GTCGTCGCAGCAAACGCACCACTTCCAACAACTTGATGATCCTGGGTGTGTCTCCCTGCGGGAAGTAGTTTCGGAAGGCTGGCGCGAGCTCGTCCACGGA
CGCGATGCCGCGACCAAAATGCTTGTCAAACTCAACGTAGCCGCCCGTCTTCGGGTCAAACACCTTGATTCCCTGGATGCGGAAGCCAACCGCCTCCTGC
AACGGGAACTTGGACTTCTCGTATGCGATCTTCTCGGCCGACGCGTCCTCTTCGTACGACCGGGTGCCCATCTTGACATCCATGATGCACGGCCACTGTC
GCCCCCAGGTCAAGTCCTCCAACGCCAAATACTCTGAAAGCAACGGCAAACGCAGCACCAATTACTGCACACCCTCGACACTAGTAAGTAAAGCTTTTCG
CCTGCTGCGTACGTCCAGGGTGCAGCCCATTGCTCTCGTCGCCGCCCTCTGCTTCAGGGACCACGACCGTCCCATGATACCCCGGCAGAAATTGCCTCAG
AGCGGCAAACTCTGGCGAGTCCTTCTCCGATACAAACACGCGCTCGTAGAAGTCGCGCTCGCGCTCCCCTCTCCGTTTGCTCTGGAAGGGCTTCAAGATG
CGGCCGTTGTGCGACTTGAGACCTTGCAATATTTGAATGCACTTTAGCGCCCGAGACGTGAGAACATTACGGCACAGATGCTGCGCGGCTTCGTACTCGT
CTTGGACGTGGCGTGGCCGCCCACTTGGTGTGCCATCTCCACGAAGCCCGCCATCGTTTT