Description :
From Genome Similarity Track
Location :
Scaffold_1380:2906- 4944
Sequence
2038 bases(100 bases per row)
AAGTTCCAGATCCACTGCATCCCTCATCCCTGTACCCTGGATCCAGGTCCTTCTATGCGGGATCCTCCCTCCTTGGATCCGAGCCCGGAAGTATGGGATC
CGGGGTACCTCGCGGTGGATCTTGACTCTTCATTAGCCGTGGCTACTAGATCCACCTTCGGATGGCACCTACCACCATTCCTTCATAGGATCCACACTCG
ATCCACTGGTACATAGTATATCCCATATCCACCTAAGTGAATCCAGGTAAGGGTGGATCCGAGATAAGTCTTGGTGGATCTTGCCTTCCCGTACATCGCT
CATACCAGATCCATCGCCATTCCATACGGGGTGCCGCTCGTCATGGCTAATCCACCACAGGCAACTTGCACCCGTGCCAAACAATTGAAATTGTCACTGA
TTCGGGATAGTGACCCCGCGTCAGGCCCATTCTCTTATTTCTGAGAAAGCACTTCACCACAATCGTCTTCTGTATGTTGTCGGCGCTGCATAACAGCGTC
CACGACGTGCACTACCAGCATCCACAACCGCTTTCTCCCCTTCGCGACACATGTCTCCCGCCAAGCGTAGCGGCAAATCGCCGGGCAAGGCCCCATCCAC
CACCCCTCCGGTCAGTCCGTCTTCCATGTCGCCCACCGATCTGCGGGTTCTAGCTCAGGCTCCTTTCGATCAGGTGCAAGCCCTGACGGCGGAGCTCCAG
ACGGCTCAAGATGCCCAAGACCAAGCTGCGTCTCTGCACACTACCTGTAACGGGGTTACATGGTGTGGAGCACACAGGGGTACGAAGTACCCGGAGAGTT
AACAAACTCTCAGTACATAAGTTGGAGAGTTAACAAGGTCTCTCAGTACGTTGGCTGAAAGCCACACGTTATGCATTTGATTAGGTTTAACTATGCTAGA
TAGTTAAAGAGATACATTTACCCCTAGGTGGCTTGGCCGCAATAATAGTAAATAAAAGACTTCTGGTTTTGAAGCATAAAAGTTAAGGTGTTAACTTTGA
GCCCTGGTCTTGGGCTGTAAGTGTCCTTTGGATAAGGAACTTAGTATTAGTGACTCTTTGAGTCGAACGTCTTCCTCTGACGCTAAAGCTACGGCAGCCC
CGCTGCACTTGGTAGCACTTGTAGTCAATCCCGCTCCTGAGTCGGTTGACTATATCCTCTGCGAGGATGGAACACCCCGTGTTCGCGAATTTGCCCCCGG
CGCAGCAGGACGCGCTTACTAAGCTTATGTCCTTGCTTGGCCCGGAGGGCGTGGCTCATCTTGCATCGCAAGGTCCAGAGGCGGTCACGGCCAGGCTGGA
ATCGTTCTCCCGCTACGAGAACGCGCTCTTGGAGCATGTCCAAGAGAAGATGAGCGCCGCAACGGCGGCGGCGTCGATGACGCGTGAAGAGTCTATGAGA
CTGAAACCGCTCATGGTGAGCGTAAAAACCTTCGAGGGGAAGGATGGAGAGAATCTCCTTCTCTGGACCCGTGAGGTCGAGATGGCCATGGGATCGGCCC
TGCTCCAGTCTGAGCATCAGCGCGTGGCGCTGGCTATCTCCAGGCTTGGAGGTCGCGCTCGCGAATGGGCACTAACGTGCGGTACGTCTGTTGACGCTGC
ATTTCTCACTTGGGATCAGCTGAAGCAACAGCTTTCGCGCGTGCTCGCGCCGCCTAATCATGCGTACTGTGTCCGGTCAAAAGTTCCTTGCTACCCGCCA
GGGGAAAGAAGGATTTATTGGGACTATGTCCAAGAGTTGAGACCTCTTTATCGCCGGAATGGGCGGCGGACTCTCTTCTCTGACCTGGTTCAGCGTGGAC
CCGTGTTCATTGGAGGTACTTCGTGTGAGCGCAGCTCGAACGGATGTGTTCCGTGTACACCCTAACTCTTTTAGAAGAGGCGGGTGGAAGTGGGCATTTA
AATGGCCGAAGCACAACTTCACTCTCGGGGCCGACCCTGGTTTGGAGACGCTGGGTAGCTGCAAGCTCTTTTCAAGCGGTTCTAAAGCCGAATGGACCCT
CATGCTATGTCGGAGAAAGGGAAACAAACCGGAACTCT