Description :
From Genome Similarity Track
Location :
Scaffold_120:29047- 31187
Sequence
2140 bases(100 bases per row)
AAGTCGATCAAGCTGGATGTTGCCAAATTCGGTGGAGCGGAGTCGGACAAATTCCTCCGCTGGCTTTTACAAGTCAGCACTGCAGCTGACGCTCAGCGTA
TCTCCGACGACGCCACCCGCGTAGCTTTCGCGATATCGGATTTGAAGGGTCGTGCGGAAGATTGGGCGTTCTCCAAACGCTTGACGGACCGCCACTGCTT
CCCATCTTTCGCGGTCTTTGAGACCGAACTCAAGGCAATGTTCCTGCCACCCAACAGCGACTATTGTTATCGCTCGCAATATCTGGCTTGCAAGCAAGGG
AAACGCTCCCTTCAAGAGATCATCCATGATCTTCGCTTCTTGGCTGCGAACATTAACGATGAAGAGTCACTCCCGGAGCCCCTACGGGTGACCGTTTTCA
TGGACGGTCTCAACCAAGGCCCGGCGCGCACGCATCTGTTTCGCGCCTACCCGGACACCTTTGAAGAAGCCGTCCGAATCGCGCTTTTGGAATCATTTTC
CTCCTCTTTCGCGCACGCACGCGCGGCGTCCTCAGACATGGATGCCTCCATGCTCGCCCAGGCATCGGACGACCGCACGTGTTTCAATTGCGGTCTCCCG
GGACACATCTCCCGCGCATGCCCCGCCCCTCGCCGTGTGGCGTCAGCCGCCCCACCCTCACACGGTTCCTCCCGTACCGCGCCTGATACCCCCTCGCGTC
GCCCTCCGAGCGGTTCACCTAACCGCTTCAATCGTGAACGCCATGGTGGTTTACGCCCACCATTCCGCCCCGCTCCGAGCTCGAGTGCGGCGGGAAACGG
TCGCTCCTCGCTCCCAGTAGGCGCGAGGCGACCTACTGGGAACACCCTAGGTCCTTTGGAGGTGTGTGGCGTGCTGACACACTCTCAGGACCTAGCCTCG
GATACAGACCTTCTTCTGTGTCGTGTTGGGCTCCAACCCAACAAAATGATTTGTTTGGAACTTGTCGTGCTCTCTGCTTTAATCGATTGTGGGGCGTCGA
ACAACTACGCCAGCCGCTCCACTCTCTCTGGTTTCCACCGCTTACCCTCTTCGGATCCCTCCGACAGGGTTCGCGTCAAGATGGCCGACGGCCACACTGC
GTCTCAACCACGCATAATCGTCGACGTTCCCATCACCTTCGACGGTTTCGACTTGGTCGAACCGTTCTATGTTATCGACCTCGATGAGAGATGGGATCTC
ATCATCGGGATGTCCTGGCTGGAGTCCCACCAGCCATGGATTAACTGGAAGGCCAAATCCGTGCACAAGGTAACTTGGCTCAACGCGAGACAACCCTGGA
TTCATAGGCGGGCTGTCGATGGCTTTCCCCCGTCCACCACCAACCCGCTTCGTCCTCCGCTAGAGGCGATGAGTAATGATCTCGCCTCTCCTAGCCCCGC
AGTGCGCTCAATGGCCCCAGCGCCCGCGGCCCCAACGGACCCAACCACGGTGCTGCACAACACCCCTTTCGTGCCCCCAACAGAGTCGCCCTCTGTTGTT
ATCGGTGAGGCTCCGCCCCCGATAGCTGCCTCGACCTTGGCAGCCACGTTTATCGAAGATACGTGTAACTTGCACGAACTCCCTCGGACGTCTTCCGAGA
TCCTGGCACTGCCAGAGATGAGCTTCCACTCGCTCGTGGAATCTCTCCGCGCCCATGATATCACCGCCTTGGCGATGATCACAGTCGAAAGAAGAGACGG
ATCTCTTTTCGACCTCGACCGCAGATGACTCGGTCCTATCCGCTCCTTTGAAGTCCCAGACGTGGGACTCCCTGCGATCCAACCCCTATTTCGACATCCT
CTAAGAATTTGAGGACGTCTTCCCCGACGAGGTTCCGTGTCGGCTCCCAGTCGACAAGGGCATTCAACACGAGATTGACCTCGTGCCCGGCGCAAAGTAT
TGTGTCACGCGGCAATGGCCGCTTCCTCGCGACCAAGTCGATGCCATCGACGCATTCTTTGCGGCTCGCAAGGCGGCGGGTCACGTCCGCGAGTTCATTT
CCCCTCACAGCAGACGGACCTTCTGTGTGAAGAAGCCCGGTGGGAAATGGCGTATTGTACACGCCTTTAACAAATTGAACGCAGCCACGATTCCGGCTCA
GATGCCGATTCCTCGCAAGGACGTTATTATCGACGGCATG