Description :
From Genome Similarity Track
Location :
Scaffold_3:29047- 30637
Transcript NameFunction/comments
Albla_Nc14004130conserved hypothetical protein
Albla_Nc14004140
Albla_Nc14004150

Sequence
1590 bases(100 bases per row)
CTTTTGTCATCAGAATCAAGAGAACAAGTAACATCCATGATCTTCCTAGACCAAAATTCACCTCGCAGACCAATCTCGCAATATTACAGAAGCGTGTCCT
CCAAGTTCGAAGAAAGCAACACATGAGTGTATCTACGGATCACAATTGAGTGACAGATTAGAAAAAAAAGATACCGTGACGCATGCAAAGTATTGACCAT
AATTAATCCAATTTGTGTTGCCGATACATCTCACTCCTCGTTTTTGCACAGTGTGTATATCTGCATCGCTCTCAGTTCTATCCTGTTGACGCACTACTGT
GTTGTATCATACTACTCAATGCTTGGGTAAAATGCACCCTAGTCAAGTGTACGTCCGTCTATCACACAGCTCAACACTTTTAGCTGAGCGGGATCACACA
TGCAGGTGTTGCGCCAGATGTGTCAGACGATTCAGTCAATTGGGTGGGTGAACTAGGGGTTCAATTTTTGATTGTCGTTTGGAAGAAAAAAGTAATGAGA
AATTGACCAGATCACATGATCAACAGCCATCTAGTGACGCTTTTGTCACAGACAATAAATCTTATCTAAAGAAAAAGTTGTGCAGAAAGTCCGATTGTGG
GCAAGTCGTTCTAGAGACTGGCAACGAGTCGTACACAAGGCAATCGATTCATTCGCATTCCTACGCACGTTAGCGACGAAGTCAACGCTTTTCTTGAAGG
TAAATTTCTTCGATTTGTACCTGACATATTAGGCCGAATAAGCCTTTGCGAACAGAATTCGGAGCACGTTTGTTGCAAAGTCAGCGACAAATATTTCTAT
CGGAGCAAGTTCAGCCTAGTTACCCTCTATTTCTTGCTGTCAGAAAGAAGTTAATGACTGCAGTCCACACGGCTGCTGTCAAATTTTCACATGGTTGACT
ACAACATTTTGGTTCATCAAACTAACTCCCAGGTTTCTCACTTTGCAATTTCCTTTGTAACAACGAAATCGAAACTATACATTCGTATTGCTCCCCAATT
TTGTAAAACTCATGAAAGTATTCGGATTCTTCATCGCCGCCGTCGCAATCACATTTGTGTCTGGACAAGAACCAACTGAGGCCCCTGGTGGAGCGGAAAC
CACACCGAACGCAAGCCCAACCGATGGAGCCAACTCGACGACGCCAAATGCATCACCTGGAGCTGCCGCTCCATCCCCAGGTTCGGCACCTGCTCCGGCT
TCGCCAGCACCAGCACCAGAGAATGGACAAAACAGTCCTGAAGGGCCTCCAGCCGAGTCAAGCACTCCCAGTCCGGATGAAGACGCCGAAGCTGGATCTG
GCTCTTCCAAAGAAGCAGAACCAACGGCTGATCAGTCGGACGCATCCATCGGATCTGAGAGTTCCGGTGCCGCCTCGTACAAGGTGATTGGAAGTGCTAT
GACTGGTGTTGCGATCCTCGTCACTTGCTTCCTCTGAGTTGACACGTTTACAACATATACCAGTATGTACACTTCCTGTCAGTGCATGTCAACAAGCTGT
TTTGAGTTTCCTAGATATGAATGTTCAAAATGACTTTTTGTTCTTTATTATGCGTTCCGTTTTCTTTAATCATCGCCTGTACACAAGCAA