Description :
From Genome Similarity Track
Location :
Scaffold_35:290418- 292385
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_20561Hypothetical protein

Sequence
1967 bases(100 bases per row)
TCTGCAACACCTTTGAGAAGCTCGGCGTCGAGGACATGTGCACGCTTAACCATTTGCACGAGCCGGCGGTCTTGAAGAACCTCCAGCTGCGCCACGCGCA
GAGCACGCCGTATACGTACACGGGCCAGATCTGCATTGCAGTCAACCCGTACAAATGGCTCGACCTCTATGGCGAGGTACGCAGCATCACACTCGGTGGT
CATCAACCTTGCTCATCGCCGTTCCATAGGATCTCTACCAAAAGTACCTGGACCAGCCGCGCGCAGAGCTTGGGCCGCACCCGTTCGCGCTCTCGGCCAC
CTCGTACCTCGACATGCGCAAGCACCGCATCGAGCAGAGTATCCTCGTGAGCGGCGAGTCCGGTGCTGGCAAGACGGAGACGGTCAAGATCATGATGCAC
CACTTGGCGTCCGTGTCCGGCGGCGGCGAGAAGGGCTCGACCGTCATTGACCAGGTCCTCAAGTCCAACCCGCTCCTCGAAGCCTTCGGTAATGCCAAGA
CCAAGCGCAACGACAACAGTTCGCGCTTCGGCAAGTTTGCGCAGCTGCAGTTTGACGCGAGCGGGTACCTCATTGGCGCGCGCTGCGAGACGTACTTGCT
CGAGAAGAGCCGCGTCGTCGGCCAGACCCAGGGCGAGCGCAACTACCACATTTTCTACCAAGTGTTTTCGCTCGCGTCGGAGCTCAAGAAGTCGCTCTTC
CTCGAGGGTAACGTCGCCGACTACAACTTTGTCAAGGTCGGCGCTGGCTCGCGCGTCGACAACACGGACGACTCGGTCTTTCTCCAAGAGACGAAGGATG
CCATGGACACGATCGGGATCGACGACCGCGAGCAGCACGGTATCTTTGAGATCGTCTCGGCCATCTTGAACCTCGGCGAGGTTGAGTTCACGGCGGTCAA
CGCTGAGAGCAGCCAGGTGTCGACGTCCGAGAACCTCGCTGCCGTCGCCGCGCTCCTCAAGACGGCGCCAGAAGCGCTCACCAAGACGCTCTGCCAGCGC
ACGATGACGACGCGTGGCGAGACGTTTACGATCCCGCTCAAGGTCGACCAGGCCTTTGACCTCCGCGACGCGTTCGCCAAGGGTATTTATTCGCGCCTCT
TCGACTGGCTCGTCGGGCGCATCAACCGCGCGATCTGCTCGACCAAGAACGTCGCGTCGCACATTGGTCTCCTCGACATCTTTGGCTTCGAGTCGTTCGA
CCACAACGGGTTTGAGCAGCTCTGCATCAACTACGCCAACGAGAAGCTGCAGCAAAAGTTCAACAGCGACATCTTCAAGACCGTCCAGACCGAGTACGTC
GAAGAGGGCATCCCGTTGGACTTGGTGACGTTCGAGGACAACCAGCCGATCCTCGACCTCATCGAAGGCAAGCTCGGCATCGTCGACATGCTCAACGAGA
CGGGTCTCCAGCCCAAGGGCGACGACCGCATGTTTGTCAACAAGGTCAACGAGTCGTTCGCGGACCACAAGAACTATGAGAAGATCCGCACCAACCCGAT
GCAGTTCAAGATCCTCCACTACGCCGGCGACGTGACGTACGACGGCACCAAGTTCCTCGACAAAAACAGGACACGCTCCCGGCCGACCTCATGGAGCTCC
TCGCGTCGAGCCAGTCGTCGTTCATCCGCGACGTCTTCCCCGAGCTCGCCAAGGGCGGTGTCTCGAAGGACAAGAACGCCAAGCCGCCGTCGCGCCGCCA
AGGCTTCCTCGTCGGCAACACGATCGCGGGTTCGTTCCGGAAGCAGCTCGGCGAGCTCATGGACCAGATCGCCAAGACGTCGACGCAGTACGTCCGCTGC
ATCAAGCCCAACGCCAACAAGAGTGCGACCGAGTTTGATCGGCACATGGTCGTGGACCAGCTCCGGTGTGCGGGTGTCATTGCCGCGATCCGCATCAGTC
GCGCCGCGTTCCCGAACCGCCTCTCGCTCAAGGAGTTTACCTCCCGCTTTGCGATCATTTGCCCGTC