Description :
From Genome Similarity Track
Location :
scaffold_1105:2904- 4392
Transcript NameFunction/comments
Pl_101308hypothetical protein PHYSODRAFT_551426

Sequence
1488 bases(100 bases per row)
GTAGTACGGCTCCGTTTGGTACTCCTCCGAGCAGTACGGAAACGTAGCACTGTCCGAGTCCGGGTTGAATAGGTTCTTGCCGGCGTAGATCATCACGTAG
CAACCCACGACGGTGCACACCACAATGACAATCAGAGCCACGACGCGCTCGTACATCGGCAGATCGCGCCAGAAAACCTTGAGGTAGAACACGAGCGGCA
GTACCAAACAGCACACAGTAATGGCCGACGCACCCGTAAAATCCACGAGGTCCAAGAAGTGCGAACGGAAGCCGATGGCGGCAGCAACCAGGATGGCCAT
GATGACGAGACGAAGTGTGACGTAACGGAGCACATTGGTCGAGCCGCTGTAGTCCGACAGCTGAGCTTCATCGTGTTCCTTCTCCTCCTGCTCGCGCTTG
GCCGAGTTTGACAGCGTCTCCGTGTCTGAGCCGGCATTGTTCTCCAGGTCTCTCTCCGCATGTCCATTGACGCTGGTCACCGGTCCATTCGTCGACAGCT
TGTCACGCAGTTCCTCCCATCCGTCGTTGTCGTCGGCCTTGTCGATTGAGACAACGTCGACGGGGCTCTTGTGCATGCCTAGAATGAGACGCTCAGCCAT
GTAGAACGGCGGCTGCAACACCGTCGACAGCACGATCACCACGTGCAGATGCATGAACAGATACGCCATAATGACAGCACCGTGGTTCGGGACGAATCCC
AGCGCTGACGGTGACGACGGATCCGCAATGTTCACGATCGAGAAGAGCAGGTTCGCCGAAAGCTGGCAGCCACCAGCGACGTAACCAGCGATAGCCACAG
CCAAGAAGAAAGCCGAGCCGATGCCGAGGCTTACCACAATGACACGGGGCATTCGTTTCGGCTGTGAGTGTTGACGCTGGAGATCTGGGATCAAGACAGC
GACGCCGTACGCGAGCGAGAGGTTACCAAAGGCAGTCAACACCTGGTGCAGCGAGATGTCGGGAGCTGGCGCGACCGGGTGACCACGCATTTCCCATTCC
AGGACACTCACACCAACCACATCGGCGATAATGGTGCCCATGCATCCGATGAACGCGACGGTCGCTGCAGCCTTCAGAGTCGGGATCAAACAAGCGGGGA
TGGCTGTGATGGCCATGAAGATGATCCAGAAAATCTGACTGAACGAGTCGGGGAACAGCACGTCGAGTAACGTACTACCTAGAACTAGGAAGGCACAGGG
TAGTAGCAGACACACGAGTAGCTGCGAGACGTTGACCAGGTACCGACCAGTTGTGCCGAGTACCCACTCCCCGACGTCACTGAAAGTCTTGACGGACGAC
GGAGCAACGAGGATGACACGGGACAACGCCACCGTGGCATAGATATTAGCGAACGCCATGAAGAGCATAGCGAGCGTGCCGTATACGGGTCCGGCACGGG
CAAAATTGGACGGCATGGCGAGCGTACCGATGCCGCAGATGCAGCAGATGATACTGAAGCTGATCTTGGCATCTTCGAGCGTGAAGAA