Description :
From Genome Similarity Track
Location :
contig_83:29038- 31934
Transcript NameFunction/comments
g10390.t1hypothetical protein

Sequence
2896 bases(100 bases per row)
AGACTGAGCGCGATGTACTCCGCCTCGCTCGTGGACAGCGACACACTTGACTGCTTCTTGCTTCCCCAGCTCACAGGCGCACTCATCAGCATGAACGTGT
AGCCTGAGTGACTTGCGGTCCGCGAGGTCGCCGGCCCAATCCGCGTCCGAGTAGCCACGAAAGTCGATGTTGTCGCCGGCTTGAAGCAGATGCCATGCGT
CTTGGTGCCTTGCAGGTAGCGAAAGATGCGCTTGACCGCAACCCAGTGTTCTCTTGGGGTTCTCCATGAAGCGCGACACATAGCCAACGGCGTACGCGAT
GTCCGGGCGCGTGGCGGTCATCAGGTGCATCAGCGCACCAACAGCTTCGCGAAACGGAGCGTTCACCTTGGTCGCCGCGTCGCTTGGAACCAGTCGAGTG
CTCATGTCCACGGACTCACCACAGCCTTGCACTCGTCCATGGCGAAGCGTTTCAGGATGTCGTCCACGTAGCGACGCTGGCACATGGTCACCGCTGCCGT
CCGGCCGTCCACCAGCTCGATCCCAAGAACAACGCGCACTTGCCGCTGTCGGTCATCTCGAAGCGCGTCTTCAGGTCCGTCTCGTGCGTGCGATCAGCTC
GGGCGAACTCCCGGTAATCAGCACGTCGTCCACGTACACCAGCACGAGCACGCAGTGACCGTTCACCACCTTGATGTAAGAGGCACGGATCGAAGGCCGA
CACTTGGAAGCCGATAGAGCACATGAACTCGTCGAAGGTCTCGTTCCACACGCGCGAAGTTTGCTTGAGACCGTAATGGCCTTCACCAGTTCCAGGCAGT
CGAAGTCACCATCCAGTTCGACGCCTTCGGGAACCACGCAGAACACCACCTCCTTCATGACCCCGTACAGGAACGCTGTCACGACGTCGAGTTGGTCGAG
AGGCCAGCCGAAGTACTTGGCGATCGCGATGATCATGCGCAGCGTCAAGTACTTGACCACGGGCGAGAACGTCTCCGTGTAGTCGATGCCGTACTTCTGC
TTGAAGCCCTTGGCCACGAGGCGCGCCTTGTACTTCTCGATCGAGCCGTCCGCTTTGCGCTTGATCTTGAACACCCACTTGGTGCCGATGGCGCGCTGGC
CGCTGGGCAACTTGGCAGCTCGAAACACACCACGCAGTCGCATCGACTTGAGCTCCGCGCGGATCGCCTTGCGCCAGTGCACTTGATCCGGACCGTTCAC
AGCCTCTTGGAACGTCGTCGGCTCCGATAGATCGGCTGCTGCTTCACAGCGTTGGCACTGGCACGCCAAAACACTGGAGGCGTCGATCGTCGTCTTCATC
TTGGTCCCCAGACTTTTCTTCTTCGTCGGGTTCAGCTCGGCGCGACGAGGATACGTCCGGCGCACTTGCTTCTTCTAAGCCAGCCGGTGGCGAACGAGGC
GCGATCTTCTGGCAGTGTCGTCGTCGCCACTCGGTCGGCTCTTGCGCTTCCCGCCTGCTTGAAGCTCGTTTGGCGCGGTCCATCGTTGCCGTCCAGGTCG
AGCGCGTCCAGGTCCAGCGCAGCATCATCGACGTCTTCATCCGAAGTATGCGCCGAAAGTCCAAAGGCCGACTCATCGAAGTTGACATCGCGACTGACAA
CCACCTGCCCCGCCTCGATGTCATAAAGTCGATACGCCTTGGACACTTCTTCGTAGCCGAGGAACAACCCGGCGCGAGCCTTGGGGTCCCACTTGCGCCG
CTTTTCCTTCGGCGTCAGGATGTACGTCTGGCATCCGAACACACGCATGTGCTTCACACTTGGCTTGGACTTGTACACGATCTCGAATGGAGTCTTGTGC
TCCACCTTGGGTGACGGCAGGCGGTTCTTCACGTAGATGGCCGTCATGGCCGCCTCAGCCCAGAAACACTTGTCCAACTTGGCGTGATGCAGCATGCTGC
GGCCGATCGTGACGATGGTCCGGATGGCGCGTTCTGCCGTGCCGTTGGTCTGGTGCGCGTACGGAACCGTGGTTTGCTGCTCGATGCCTTCGACTTCGTA
GAAGGCCTTGAGCGAGTTGGTCGCGAACTCACGAGCTCCGTCGTGCCGCACAAACTTGACCTTCTTGCCGAACTGCGTCTGCACCTTCGTGACGTACGTC
TTGATGCAGTCTTCGCTCTCCGACTTGGCACGCAGGCAGAACCCCTTCATGCATCCGCTGGCTTCGTCCACGATCAGCAGCAGATACTTGCTGCCACCCA
GTGACTCTTCTTCCATGGGGCCGCAGATGTCGAAGTGGAGCAGCTCGAACGTGTCGTAGCGACGCTTGTCACGGTTGCTTGGGAACGGCTTCTGGACCAT
TTTCCCTTGCTGGCAGCCGCGACACACGCTTGGTCCACTCGACTTGGAAGGTGCCTTCGCGTCCTTGATCATGTCGTTGTCGACCATCTTGCGAAGCACC
TCCACCGGAGCGTGACCCATACGCGCGTGCAGGTCGACCGTCTTCCCACTGGTCGCCGCATTCGCCGATCGCTGAGGCGTCTGGAGCCAGTAGAGGCCAT
CCACGAGGTTCGCCGCCGCCACCACTTGCTTGGAGGCCTTGTGCGCAACGCGCATCTGGGTGCCGTCGAACACGACTTGGAACAGACCACTCTTGTTGAT
CTGTGGCACGGAGAGCAGATTCTTGCTCATGCTCGGCACGTACAGCGCGTTCTTGATCTCGATGTCGCGCTCGTCGCCGTTGGGCAGAACCACTCGTTCC
ACGATGGTCCCCACACCCATGATGGCCGCCTTGTTGCCGTCGGCCACCGAAAGTTCGCCCTCGTTTCGCTCAATCAAATGGGCGAACTTGGCCTTGTCGT
TGCAGATGTGGTGCGTTGCGCCGCTGTCGACCGCCCACATGCCGAGCATATCCTTGCCCGTCGAAATGCCACACTCCAGTGAGACCGCGAACGCCA