Description :
From Genome Similarity Track
Location :
Scaffold_76:29036- 30112
Transcript NameFunction/comments
Phyin_T30-4PITG_18687Mitogen-activated protein kinase%2C putative

Sequence
1076 bases(100 bases per row)
TACCAGTTGATTCGAGCCATCGGCCACGGCGCGTACGGAGTGGTGATTGCAGCTAGCGACCAAGTGACTGGCAACTCGGTGGCTATCAAGAACATCCCGC
GTACGTTCGATGATCTGGTGGATGCCAAAAGGATAGTGCGTGAGATCCGACTCATGCGGCATCTGCGTCATCCTCACGTTGTGTCGGTGCTGGACGTGAT
GCGTCCTCCCTTACTCGTCACGTTCGAGGACACGTACATCGTCACAGACCTCATGGAGACGGATTTACATCGCGTCATCAACTCTCCCGAGCCGCTTTCG
AGTGATCACATTGCCTTTATCACGTACCAATTGCTATGTGGTCTACGCTACGTCCACTCGGCTCACATCGTCCATCGCGATGTCAAGCCGTCGAACGTGC
TGATTAATCGCGACTGCTTAGTTAAACTCTGTGACTTTGGACTGGCACGAGGCATTGACATCCGTCCAGGTACACCAAGTAGTTCAGACGGGAACACGAC
GCCTAGTAGTCAAGATGGCGAGCCGTCATTGGACGAAGCATTGACAGAGTATGTGGTGACACGCTGGTATCGAGCCCCGGAGCTTCTACTTGCTAGTCGG
TACTCTACGGCGATTGATCTCTGGGCGGTGGGCTGTATCTTAGCCGAGATGTTTACGCGTAAAGCGCTCTTCCCAGGACATGACCACGTACATCAGTTGC
ATTTGATCCTGCAACTTGTAGGCAGTCCGCCACCGAACGACATGGGGTTTGTCACCAACATGAAGGCCAAGCGCTGGATGGCACGTCAGCAACAACACGA
GGCTAAGCCTCTGAACACGGTGTGTCCGAATGCCCCCACTGAAGCTCTGGATTTGATGACCAAGCTACTGCAGTTCGACCCTCGCAAGCGAATCTCAGTA
GACGAAGCCCTTGGCCACCCGTTCCTGGCCCCTTGTCGAGCGGATGGCGTTGAGATGGACTCGGAGCGTCTGGCAGATAGCGCGTTTGACTTTTCGTTCG
AACGAGAGCACAAAGGCAACTTGGACAAGAACACATTGCGACGACTTATCTTTGAAGATGTTTGCCACTTCCACCC