Description :
From Genome Similarity Track
Location :
Scaffold_81:29027- 31502
Transcript NameFunction/comments
g14482.t1hypothetical protein

Sequence
2475 bases(100 bases per row)
CCTCGGACTTCAGGTCAGAGGCTCCGCCGCCAAGCATCGAGCTCACAGCGCAGCCGACAAGACTAGAGACCGCATCGGGGACTTACTTCACACTCGTGAC
ATCTGCAGGGACCCACGACACCTCCAGCCAACGCGTGACGATGACAGAGCCACCTTCTGTGGTCCTCCAAGCAGTGAAAGAGGTCCAGGCCCTTGGACCC
TTCGAGTTGGTGCCTCCACGACCAAAGGAGACTTCGTACATATTCAAGTGGGGGGTTCGTGTCAAGTACATCGAGAACGAGAAGGAGGTCTTCGCGTGGG
CTTGTTTGGCCGACGAGGCGTGTCGGACGTCAGGAAAAAACCTGTTCAAGCTCTATGCTGGCAAAACGACCATGGCCGTGAAGCACCTCCAGAAGATACA
CAACGTTGGCTCGCCGAAAACAAAGATAGCGACCGTCAAGAAGCGCAAACACGACCATGATTACAACCACCTGTCATCGTCCGCCCTGTACTCAAACAAC
CCAACCCGGCTAAACGTGCTGATGACCACTCTCATGATCATCAACCATAACTTGACGTTTCGTATGGTGGAGTACGAAGAGGCAAGACTAATCCAAGCGC
TACTCTATAAGGACGAGATGAAGGCCAAGATAACTACAAAGCAGGTGAAGGAATCTATCGTGGAGCTGTATTCTTCAACACGCAAGGAGATCACTAACTA
CCTCCAAGAGAACCGAGAGGACTACCCGAACTTTACGCTCGTGGCAGATTTTTGGACTTGCAAAACAACGCAAGACAAATTTCTTGGGTTGCGGGTTTAC
CTGGTGGACAAGGCCTGGGAGTACAAGTCCATTCTCTTGGGAACGAGAAAGTTCAACCCCGCATATGGAGATCGTGATGGCGGCATTGTCAAGCCCTTCA
AAGGGTGGTTGAAGCACATGCTCGAGGACTTTGGCTTAGCGACGAGCGATTTCTACGGGGCTACGAGCGACTCGGGGGGTGACGTGAAATCGATGCTGTG
CAAAGAACTCAATCTGCACTGGGAGTGGTGCTTCGCACACATGGCCCACGCAGCTACAAAGTCATCATGTGGTGTAAATGGAGCTGCTAGTGCTGCAGCT
AACCCGGAGATGGCGGACTTAATCTCACGGATGGTAAGAACAATATTTCAGGTCAAGGTCGTGTCTGTCACTGGGAGCTTATTTGCAGAGCTCTGTAAGT
CTAAGACTCAGGGTGCCTCCACGCGACTTGTTGGATATTCTACTTCACGTTTCCTGAGCATGACGCGTTCATTGGAGAGAGTTCTTGAGAAGTGGCCAGC
AATAACTGCGTGGTATGAAGAGCGAGCTCGTAAAGCACTTCGTGCCAACCAGCCACCACCAGAGTTCCCGTTGGCTAATCGCCATGACGACTTGGTTCAT
GTGTTGTCTGTGCTGAAGCAAATCGGTGAGATCAAGCGAACATGTCAAGCAGAGCATCCTGTTCAAGTCGACGTGCTCGTACAGTTGTATATGATGCGTA
TTCACGACCTCGACCCTGATCAGCCTTTGCCACACTACCTATCAACCGACAAAAATCCTCGTTGGATTCCTGCAAGTGACCTTACACCACTGGCTGCGGA
TGTACGGAGACTATTGCGGAGAGCATTGGACGAACGCTTCTTCAGCAGATATTACAACGACAAGCAATTCCACAAGTGTCAATTTGTATTTGAAATGCAG
TTGAAACTCCACCCTATCTTCAAACGAACGGAGAGGAGCCTCGATCGTGCAGTGATTTTGTCGTGCCGTCAGCATGGCAAAAGCGAAAGGGATGCTGTGA
CCAGGAAGAATGATGTGAACGCCAAAATCCGCTGCAACTTATTGGACTTACTTAAGGCAGTAAGTGAACCCGCGGACGTCTCTGAATTTGAACCACCTGC
ACCTGTTGTGCAAGTCAGTCGACTGGAAGCAGAATTTGCGCCGAGATCAAGCCGACCACCAACCTTTAGCCGGCAGGATCGACGCGCAGAAGAGAAACTT
GATCGATGGCTGGAAGATCCTGTCGACATTGCACGAAAAGAGGACTACACACCAAATGAATCAGTACTTGAGTTTTGGCAAAGACTTGAGCACCAAGGCG
ACACCGTATCATACCGAAAGCTGTGAGAGTGCTGTTCTCAATACGAGTATCTTCGTGCCAGATTGAGCGTGATTTTGGTGTAAGCGGGCAGATGGTAACT
ACACAGCGCACGACATTAGCCGAGCACAACATCGATATGTGCTCATTCCTGAACAGAAACAGCGACTTCGTTGATTTATTGCAGTGTGAGGAGATCCCAA
AGGGACAGCATCACTTGCACACACCTACAAGCTTCATCTTCCCCGTCGCTGAAGAAATGGACTATGAGCTGGACGAGATGACAAGCGACCTTCTGGCCGA
CTTCGCTTCTAGTATGTCACTACCTGACGACTTCGAGGAAACGAAATCGGAATTGTGAATGTAGTAAGAAATTGA