Description :
From Genome Similarity Track
Location :
contig_64:290248- 292211
Transcript NameFunction/comments
g11082.t1XP_008911776.1 hypothetical protein PPTG_15780 [Phytophthora parasitica INRA-310
g11083.t1XP_009531563.1 hypothetical protein PHYSODRAFT_562522 [Phytophthora sojae

Sequence
1963 bases(100 bases per row)
ACGGAGAGTGTCTTCTAATGTCTGCATCAAATTGGTGTCAAATTTGAGTGACGGAACTCTTTCGACAGTGAAGCAGCCCATTCCAGTCATCCCAAAGAGA
TGCAGAACTGCTACTACCTGCTGCCGGCGCAGCCCACGCTGCCTGCTCCTGCCGACGATGACGCGCCAATGGGGCGTCTGGACAAGTCGCGTGCCAGCTC
CGACGAGATGCGCCGCTCGTTCATGCAGCTGGGTGCCGTGAGCGGCGCCGCTGGCTCCGCGTACGTGGAGCTGGGCCGCACGCGCGTGGTGTGTGCCGTC
TACGGCCCGCGGACGGACACACGCGCGCGCCGCGAGTTCAGCAAGGACGGACAGCTGGTGTGTGACGTCAAGTACGCGCCATTCGCAGACAAGTGGACCC
GGCGCGAGCGCGGCCAGGACCCGGACGAGATGGAGCTATCGGCCATCGTGGAGGAGGCGCTGGCCCCCGCCGTAATGCTGCACAAGCTGCCCAAGTGCGT
GTTATCGCTGTTCGTGACAGTGCTAGAGGACGACGGAGGAGTTTTCGCTGCGGCCATCAACTGCGCGTCACTGGCGCTGGCGGACGCCGCTGTGGAGATG
TACGACGTGGTCACGGCTGCTAGTGCGGTGAGTTGTGCTGTAATTGGGGAGTGGCTGTGGGGAACACGGCTCTGACTGGTTTCTATTGATGAGCAGGGTA
TTGTGAACTCGACTGTGGTGCTGGACCCGAGCAGAGAGGAGGAGCAGCGCGGAGACGGCAAGATGGCGCTGGCCTACATGCCGTCGATGGGACGGGTTAC
ATACATGCTGCAGGCGGGCAAAGTTCACCATACGCAGCTGCAAGAAGCCGTGGATCTATGCACGGATGCTTGCACGGGTGTTACGAGGACGCTGCTCACT
GCATCGCTCGTGCAGGCGCTGTCCTGAACTTCTAGATAGGAAAGCAATAATACATCCCATCACAGACAGTGAATAGAGTTATGCGTTGTAGTGATGTATT
GTGCAGGCTTCTTCGCGCTCGTCGATACGTTCACATCTTGCTATTGGGCATACGTCTAGGCGACGACCTGCTGCGCCTTGCGGTTCTTGAGCAGGTTCTT
CATAAAGAACTCACCAGCCTTGTAACTGGAACGCACCATCGGGCCACTAGCCACATACAGGAAGCCCATCTGCTCGGCCACCTTCTGCCACTCAGCGAAG
GCCTCCGGCGTCACGTACGACTTGACGGGCATATGCTTGGTGCTCGGGCGCAAGTACTGGCCGAAGGTCACCACATCCACGCCGCTGTTGCGCAAGTCAC
GCAGGGTCTGGAACAAATCCTCGTTACGCTCGCCCACGCCCAGCATCAGCGACGTCTTGGTCACGAGATGAGGTGCAGCCAGCTTCGCCCGCTCCAGCAC
ATGCAGCGACTGCTTGTAGTTGGCACGGTAGTCGCGCGCACGGCGCTGCAGCCGCTCCACAGTCTCCAAGTTGTGTGCAAACACGTCAAGTCCCGACGTC
GCGACCTGGTCAATGAGGTTGTCGTGGCCCTGGAAGTCGGGGGTTAGACACTCGATGAGGATCTCGGGTAGCTTGGCGCGCAGCGTGCTGACAGTCTTGG
CGAAGTGTCCAGCTCCCAGATCCTCGTAATCATCACGGTCGACGCTGGTGAAGACGATGTAGTCGAGTCCCCAGGCAGCGATGGCCTCCGCCACCTTTTC
GGGTTCCTCGGGGTCCAGCGGCTTGGGTTTCTTGCTCGTCTTGATGGCGCAGAAGCTACAGCCGCGTGTGCACGTGTCACCCATGAGCATGATGGTGGCC
GTGGCGATGCCGTCCTTGCCTCCGCCCCAGCACTCGCCGATGTTGGGGCACTTGGCCTCCTCGCACACTGTGCTGAGCCCGAGGCTCTTAACGGTCTTGC
GCAGCCGTTCGTAGTTGGCGCCCTGCGTGGGCTGCGCCTTGAGCCACTTAGGCTTGCGGTTGG