Description :
From Genome Similarity Track
Location :
contig_49:29018- 38114
Transcript NameFunction/comments
g9669.t1hypothetical protein

Sequence
9096 bases(100 bases per row)
GTCCGACAGACACGAACGTGGAGCTCACGCCATGTAAGCGAAGCCCCTCCCCCCAGTATTCGTCATTTTCATAAAGGCTAATTCAATTGCAGTTCTTCCG
TCGGTCGTGTATGACAATTTGGATGGGGACAGGACGGCGAGTCTGGTGACTCCGAGCGGTGGAGTACTTGTCGCCCACGTCAACTACAGAACTGTAGGTT
ATCAGTTTGCTGACCAACCATGGCATTGGTATTAAAAACACCTAACGCATTGTTGTTTGCCATTACCACTCACACCAGGATGCTCGATATTACACGGAAA
ATGTACTCGAATCGCGACTAAAATACCCCAGTACGTATCTGGTTATTGCAATTGGAAATGTAGAACAGCAACTGACACACTCGAATGCTTTCCGTTTTGA
AGCTTCACTGAGTCCATACGCAAAGATCTCTTATGCGTCAAAACCATTCTCAGCAACAGCGTACAAAGCTGGGCAAGGGCCAACTTTTCTGAAAGACTTT
GACGCTGCCCCTGCACCCGTGGAAAGCGACGGGTTTTGTGAGCGAGAACTATCTGTACTGGGACCTTTATTGAACACTCAGAGCGATCTTTGCGGCAGAT
TCAAGCAGGTGGACACAAACGTGGGTTTTCTGATGCAAGTGGACTTTGTGGAGTCTAGCCCAGTTAATACAAGCTGGTCGTGGTATTTAGGTCTGCCCTT
TCGGCTCGGTAACGGCGCTGTCGTGGTCCTGGATGGTGTGGTGATGCAAGATTTGATGGGCAAGACTGGGTATTGGAAAGGTGTCCTCACAAAAACCACC
CAAGTTGACATGAAAATCACACCCGGTTTTCATGTGTTGAAGGTTTACGGATTATCTGCAAAGTTTGAAGCATCGAGTCTATATTTCAGTCGCGAGGGAT
CCAACCCGGTACTCGTTTCCACCGCTGCTCTCATTACGGAACTCACAAAATGGACTCCCTTTGCTGCTCCTGATTTTACGATATCAGCTACGCTTACGGC
TGAACAAGCTAACAAAGCTAGCAACGTTGGCAGAGGGGTATCAGTACTACAGTTCCAAAGTGCACCTGTTGACGGACGCTTCGCATTGCACTTAGCAGCG
CTATCGACGACAGATACCCCGAGTGCTAAGCTAAATACCTCGTCCTTAGTGTCCTTCTCGTTTCTTCCAACTTCGATGTGGGCTAGTGCAAGGGCATCTC
AAGTTTCTTTTGCTACAGCGGTTAGCACACTATGGAGTGCGATACCTGGCTTAAGTATGACCCTGACGCCTGCAACAAGTGGGGTTCTCATGTGTTCTTT
TACGGGAAGATTTTTCGTGGACAAAAGTACTGTGAAAACGTTTCGTCTCGACCTTGGGTTCGGCACAAGCACTACATCAGTCACCTCACAGTTTCGCTTG
GATGAATCATTTATTGACCCTTCTGGTGTGCCTCTTGAATTTTCTTACTTTACTAGCGTTCCAACAGCCAGCGCACTGAGTATCTTGCTCAGTTATCAAT
ACCAAGGAACGAAGACTGGAAAGATTATTGGTAGCAGAACGACAGCCACATTTGTTCCAGGGGGTTCATTAGCTACTGAAACCTTGAGCGACAGCACGGC
TGCCTTGAATAGCACGATCTTCTCCAAAATGGTAGTACTCTCTTCCTCAAGCACATTGATAATTCGTGTTGGTGGTACCATCTGCCGCAATGCAGCCACC
GAAGTATTTCGTGCGCGCATATCGAAAAACGGAAACCCGATCTTTGATGGAGATTTCTCTTCAGTGGCGGGGACAGTGTTGTCAGGAATGTGTGAGCCTT
TGACAATGCACTCTATTATCGATTGTGTTGCAGGCTCCCACACAGTAACAGTTGACGTTAAAACATCGACGAGTTCTGGGTACCAGTTAAAAGGGGTGCA
ACTACAAATTGTCACGGTCGAGAGAGGTGCCTTGCTGTCGCAAGAAATGTGTCAGTCACGCTGTTCACGGCATGGTCTATGCCGAGTAGGCGTATACAAC
ATTGCTACGAAGGCATGCAACCTTTATATGACTCGCAATTCGTCCTCGTTAGTGACAGATCCAACTCGCGTGGCGTTTGTAAGAACCCAGGAAGTGGTTA
TTTCGGGGAATGCGTGGACGATTCTTCACAACACAAAGTGGGCACTTGGACAGAATGTATCTCTTGCAACCCCATGCAAAGGCGACGCGTGCGGAACTGG
TATTTGTTCTCAAACGTACACATTGAAAGAGCGCTGCCGATGCATTTGCCAATCAAGCAGTGACTGTGTAGGCTTCGCAAATACGGATGGAACATGTTAT
GCTATCACAGCATCAGACTTTCGCCAAAGTGTCCAATTGGGCACATATAATACCTCAGGTGCCGCTACTATTCATTTGAATATGCCTCAGACTTGCCACG
CTATCAAAGTCGATGCCCCAGATGCGGCAACTGGACGATATGTCATAGCGACGTCAGCAGGAATATATGATGCGTTTTGCAATATGACCGCTGATAGCGG
TGAGGGATACACGATTGTGCCGTGTGATTTGGGCATCAGTGACATCAATTGTCTGAGCAGTGCTAGCCCAAAAGACAGTGATAGTTGTAAGATCATGGGT
CTTCAACAAGTGGTACCGCGGTCTTCGGGGCATTTTATATCAATGCACCGAAAATATGGAGCACTCTTTTTCTCGACAGTTCCCGGAGTAACCAATGCCT
ACGTTGGCGATAGTATTGACCTACCAAGTGATGACGAAACTGTGCTCGATTGGACAGCAACCGATGGAGGAAAATGGTGGTTACGTGATAACGGTAGCAT
TTGTGATACTGTATCGCCTGCGAATGCACCAGACGAACGAAGGTGGATAGGCATGCATTCTGCTTTCAATGGCCAAAGTGTGTCAGACGGCTTATCTTTT
AGTTTTGATCCTCGTGGACTGGCAACGACTAGATACTTGTGTTCTACCAACGACGTTAGTCCATCAACCTCTTGGAGTGTCACTCTCCAAGACTCTTTTA
TTGGAAGCGGTGATGACAATCTCTGGGTAACTTCTTGGAGCGGTGCAGACAAGTGGTACCAGCTTTGTCAAGGAATCGTAATTCTTGGAGGTAGATCATT
CTCACGGGTCGGATCCTTTGTAAGGAAAACATTGAGCCCCATCAACAAGAGCGACAAACCATTTAACGCGCGCGTCAAATTCACATACTATTTTGTGTTT
GAACCACTTTACTGGGTAGCACTTCTTCTCAAGAGCTCTGAACCGAGGACTATTCGGGTTTACCTTGGTACCCAACTTGTTCGACAGCTGCAAGTTGATA
CCTCAGTGACCTATGCTTGCTACGGACAGAGTTCGACCTCAGCGCAACAGGCATACTTCTACCGTGGAAGGGAGCGATTTGCTGTGAGAGGATTTAGCGG
AGCAGCAAACGAACTACGTTTTGAAACGGATTTTGGTTCGTTGAACATCAGTGCCTTTGGGATTGACGAAGTTTCAATTGAGGTGGAATCATCGTTTAAG
ACACCTCTAGGACTATCGTTAGCAAATCCCGCGGTTTCATGCATGCACCTGAAGAGCGAGCGTGCTGCCAACGGTGATGTGAATCCAGATGGCCAGTACT
ATATTCAACTCGACCCAAATGTTGATCCAGTCCTTCTTCCTTGCTCTGACGGATGGATAGTTGCACAACGCCGTGTAAACGGCAAGACAACTTTCAATCG
CAATTGGAATGAGTATCGTGACGGGTTTGGTCTTGGTTCTGCCAATGAGTGGTGGATTGGAAATGATATTCTGGCTACTATCACAGCACGAGTCACCGAG
GCAATCATCGTCGTATCCAAAGATTATAAGGACACTTCCGCGTTTTATAGTGATTTTCGAGTGGCAAGCGAAAAGGAAAAATACTTATTGACTGTGCGAG
GGTACAATTCGACGGCGAGTTATGCAACGGATGCTCTTACCCCGCTTAGTAATATGTATTTCAGCACACCAGACCAGGATAATGATCTGTCCGCGAGTCA
AAATTGTGCGAGGCGAAGCCGGAGCGGATTCTGGTATGCAGACTGTCTTAGTGCAACTAGATCCGATTTAAACGCGCCATTTGACATGCTACCCATTTGC
ACATCCTACGCTGCATGGGCGCAAAGCTGGTGTCAGAAAACGGGGAGTATAGTATGGGATAACGTGGATGGTTATGACTCCTCAAAATTACTTTTACGGC
CGGACAGATGCCCACCAGGCTACACGAGTTCACAGAGTGGCGACTGTTCACAGTGTCCGGCGGGTACCTATTCAGAATCACACTCGAACGGATGTACGAT
GTGCCCTGCCGGGACGTATGGGCCGTCGGTTGGGTTGTCAGGTGTTGCAGCGTGCATATCGTGCCCATCAGGTTTCAAATGCTTAAGCGGTTCAACAACA
CCAGCTAAGTGTTCTGTTGGCACCTTTGCTGACGCTGGATCAAGCGAATGTTTGAATGTCCCAGAGGGTTATGCGGGTCCATTTGATCAGATGGCTCGAA
GAGATTTCGTTCCTTGCACGAATGGAACTTTTTCGAAGCCAGGTCAACAAAATTGTAGCGCAATCCCCGCTGGTTTCTACTGCCCCTCCAGCGGGGCCCC
TTGTGCCTACACTGCGTTAGCGCCTTGCCCCTCTAGAAATGTGTACTGCCCAGAAGGAAACACTGGCCCTATCATTGTGCCACCTGGTTATTACTCTGTC
GGATCGATGGTGAATGAGCAACAATCTGGAATACTGTCCTGTCCAAGAGGGTATTATTGCCGACGAGGCACAGCATATCAGTGTCCACCTACTCGATTCG
GCGATCAAGTAGGTCTCATCAACTCACTTTGCTCTGGTCGATGTGCGCAAGGTTGTGTTTGTAAGGCTGGAAGCGTAAGCCGATGCCCAGATTCTCCCAG
TGGCGCTGACCAAGTAGTTTTGACTTCGTCATCAATCTCATATCTTCTCGCACCTTTATCGAAACAACCAGGTTCAACGGACGACGCCCTTACGCAAGGT
GTTTTTGCTGCTACAAGTAGTTCTGCGGCTGTTTCTATAGACGTTTTCGAGTTCAAAGATGTAAACCTGACTGCGTTTAAGACAGGGTGGTCTTCTGGGT
TTGCACACAACATATCGCTTTCTTATTTCGAACATTCACAGACGGATATCACCTACGAGTTCAACTGCCCGTTGCTGGATTTGATTGGGGTGCTGTTGTA
TTGCTAGATGGGATTATCGCGGTTCCTCGCTCACGAAATGGTACATTCACATTTGCGTTTGTGTCATCGTCCGGGGCCCAACACTATTTGTCCATTATCG
CAGCTGAATCACAGTTTGCAGCCAAAAGAACAATTTTATTCCGAAAATCTACCGATGCAAGCTTTCGTAACTTGCGCTGCGATCGTTTCGACGGCCAGTC
TATCTCATTAGATATCGATATCGCGGTATGCGGAATTGCCGCCCCAACTTGCACGGGTAGTGTCTATGTCAACGGAGAAACGGTGAAAACTATAGCAGAT
ACAGCAAATATCTTACATATTTTAGTGTACTCGGCACTTGGCACGAAGATGTTTGATACTACTGTTGACGCTACGATGTCTAATAATTATATGCCCACGT
TATCTGCGATGGGTGCTGGGGATATTGCTGTTCTCGTTGGTACAAGTATCGTGAAAATTCCGTCGAGTTTGAGTACCTGGATAACCGGGTACGGCATATC
TCAGATTAGTACTAACTCTACAGCCTCGGGCTTTTTGTTCGTTGGCGTCAATGACAGTACTACTCCAGCGACGTTCGAGGTGGTCACCCCAGGATCACGT
TACAACTTGCAGATGGCACTCCCGCTATCACAAGCAATCTCGTATTACAATGCTATCAATGTCCCAGCGGGTTACTATTCTATTCCGGAGGGTTCTGTGA
ATGATCGCCGATTCGAATACAAAAGGTGTCCCACGGGCTATAGTTGCTCAGGTGGTGCTCGTAAGCTGTCGTTTGTGTTCCCAGATTCGATTTGTGTCGA
CAGAAATCACATTCTGAGCATCCACGAAAATGACCCTGGATTTGTCTCGGATGTCAGTTTTAGCCTCGCATCTTCTTCAATCGGTATGACGTATAACCTC
CAGACATGGACCACTTCTACAAACCTTTTCAAACTGAACGAGCAGAAACATTTAATCCTGATGAAGGCATTAGACTACGAGAATCAAAACGCATACGAAA
TAACACTCATGATCCAAGAGACCTCAGCGAGTGCACCGTTTGCGGCGTGTAAAATCCATGTGAATGTGGTAGACGTCAATGAGGCACCCATCATTAGCGG
CTACCAGTTTTCTCGAGCATTGAAGGAAAATACTCTACCTCCCGCAACTCTCATGCCTGCTGTTGGTGTCATTGATCCAGATGCATACGACACGCATACC
TTATCTATATCTAGTGGTGGGAATGGCAACTTTGTCATTACTCGGGATGGTAATATCGTTGCGATCAACGCTATTGACTATGAAAGTACAACGGAATTCG
TATTGGATGTTGTTGCAAAGGACGGTGGTGGCTTGGAATCTCACGCTAACGTGGTTATCGTGATCCAAGATATGCCAGAGCCACCAAGTTGTGTATCCTT
TTCATTTAATGTGGCTGAAAATACCTCGATTGAGACTGGGTTGCACAGTTGAGTGGGTACGCATTCGACCCCGATTCCGGCGACCATCTGATATGTGAAG
TATTATCTCAAATCCCGATAGGAACAGTTGATGTGGATTCTTCCACTGGTAAAGTGACGTTGAAAAAACATCTCAACTACGAAGTCCAGGACACCGTGCC
CTTCACGTTCGTTTTACGGATAAAACGGGGCTTCAAACAGTGTGTGATTATCGCATCGCTGTGACAGACTCAAATGATGCTCCAGTTCTAACAAGTGCTG
TTTTTCGCGTTCCGAAAACTGCATCGGGAACACATGCTTGGTAGGAAATCTAGGTACTTTTGCTGTTGATGAGGACAAAGGTGCAGTCCTGACATTTCAA
TTAACGTCCACGAGCGACTTTCTGTTTGTTCAAGGTTCTCAGTTATGGTCAAAACCGATGGATTTTGAAACGAATCCTGCAATTCAGATATCAGTTACAG
TTTATGATGAAAAAGGCAGCAGCGATGAGGCAACAATGACTGTGCAGGTTGTTGATGTAAATGAAGCTCCTACTGGATCACCCTTTACGAAACAAGTGGC
AGAGAATGTTCCTGTCGGAACTGTGATTTTAGCGTTCGACGCAGTCGACCCAGAAGGCGATAATATCAGGTATACAATTGTTCATTCAGCTGGCAAATTT
GGGGAGCTTTTTGGTATCAACGGTAGTTTCCTGGTGACAATAGCTGAACTTGATTATGAGGCGTTATCGATTCATTCGCTTGGGGCCAACATCAGTGCCT
GCGATCCATTAGGCATGTGCGCCGAGATTGGTCCAAATCTTGTCGAAATTACAGATGGTCCCGATGCGCCTGTTGTGAACCGAGTCGTAGATGGCGTTAC
CATTCCCGAAACCACACCTGTTGGGGCATCCTTGATTCAATATGTTTGTTTTCAGATGAAGACACCGGCCAATCGACAAAACTTGTGTACTCAATACACT
CCGGTAATCCGCTTGACCAATTCACTATTTCTGAATCTACGGGGAAGCTGACTGTGAATTCACAACTGAATGCTGAAATTGTCAGCGAATACTCATTCGT
TATTCAAGCCACTGACCCAGATGGGCTTAGTGGGCTCTCTCATCCAATTGATATCGCTGTCAAAATGATACCCTCACCCCCACAGTTTGTTGGGGCTATT
ACAGCGCAGAGTTATTATCATGTTGACATTAGTCAACTAGGGGATGGTTCTTATGCTACCGTGTCCTTACCAATACATGACAGAGATCCGGGACAGATTG
GAGGAAAGTGCTCCATCTCGGCGGACTCAACTGATAATTTCAAGATTGTAACCAGCAGCGACACCACGTCATGCGAACTATCTGTGCGGCCAGCGCGTAT
GTACCTGACGATCAACGCGTTAACATCACATTGCGTGTAACGGACACAGTGAATTCATCTGCGTATAGTGAAGTGACAATCGGTGTGCTATCACGAAATA
TTAATCATCCACCTAAGTGCACCAATGCGCACACTCAATTGATCGAGAATGTGCCTTACGGTACAGCTGTTGGTACTGTCATAGGAAGTGACTCAGATGC
AATCGATACGGTTTCATTTTACATTGCAGCTGGAGATGATGATGACGTATTTCAAATAGATTCGTCGAGTGGGGCTGTCACAGTGGGCACGAAGGCTCCT
GATTATGAGAAAAAGGCGCTATATTCGCTAACGATTCGGGTTCGAGATGACGCCGCAACCCCACTCGCTGGCACGTGCACATTATTATCGATATTTTGAA
TGAATTGGAGTCTCCCGTTTGCTCGTTAGGTATCTTTGTTAGCGCTCCCGAAAATAAAATCAGAGACACGTATGTGGGAGACGCTATCTGGAAATACTGT
ACAGACCCAGATACAGGGCGGAGTGACTCGACATCATTCATCTTCGAACTTGTAGATAGCAGTGTTACTTTTCGGGTTGAGTCCTTTACAGGTCAGATTT
CAGCAATTGAAGTGCTCGATTTTGAAGAACGTCCCACCTACAACTTAACGCTTATTGTCAGAAATGCGTTTCGGCCGGCGAAGAGCTCATTTGTGGCGTT
AAACATTGAGGTGATCGATACCAATGATCCGCCCCAGGCTTCATTCCTCGCTTCATTTCCTAGCCTGACAACGATGAACGTAGACATTCCTGAATCATCT
ACGGTGGGTACAGTAATTGGTGAAGTAGTTGTTTTCGATGAAGACGCTGGTGATGTTTGCACAGTGCAGATATCAGACCCCTCTTCAACGTTCGCACTGG
AGCAGATAAATTCCACAGTCTATAACGTTAAACTGGTAAAGCCTCTGGATTATGAGACTCGGTCGTCTTATCCAATAGATATATCAGTATCGGATCAGGC
TGAAGCTGCAACGCTGCTGTCGTTGCGTGCTGCTGTAACGGATCTTAACGAAGCTCCCTACTTTGAAGCAAATCAGCATTTTTTCATTGACGAAAA