Description :
From Genome Similarity Track
Location :
Scaffold_23:29017- 35281
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_23-snap-gene-0.57Neutral ceramidase
Pytap_DAOMBR444maker-pag1_scaffold_23-fgenesh-gene-0.1Conserved gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_23-snap-gene-0.58Phosphatidylinositol-4-phosphate-5-kinase (PI-PIPK-B)

Sequence
6264 bases(100 bases per row)
CGTAAACCAGTTGCCCATACTCgTTGGATGCACTGCAAaCCAGTTGATCATGCCAATAGGGAAACCATTGACTCCATCGAGACGCCAAAGGGTCATCTCC
TTGTCGGTGTTGTGCTTGTACTTGGCACGCTCCTCTTCTGGGTTTGCGTTGTACGCTTCTTCCGACCGGTTCACCGATGCATTCAGGCATTCTCCCTTGG
CAACACGGATGAAGCCTTGTTGAAGGTTGTTGTGGGCACGCACGATCGACTCCACAATACCATTCACGACGCATTCGAAGTTTTGTCGATCAGCACCGCG
CAGTGGTGGATGCATGCTGTAAATAAAGTAGTGCGACATCCCACCAGGCGCGCAGTGTGTATGTGTAGCACTGATCATGACGTTCTCACGAGTGTAGCGG
CCCTTGGGTAGCGACGGATGAAGGGCCAAGCGCGAGATCACCGTCTGCGTGACCCATTCCGAAATCATGCCGAGATCACAGCATACGTACACGCACGCTT
TCTTCGATGGCGCATGGAAAAaTGCGAAGGCACGCGATCGTAGGCGCATGTGAATGCCTGACGTGAGCTGTCCAACCTTCGCATAACCAAACATACCAAC
CTCTGCCGCCGGACCTGTGATATCAAACATCCCGGCACCAATGTGGAGGTCTGAATGCGAAGGCGTCTCCGGTGGTGGATACGGAGGGTCCGACGAAGTC
GAGCTTGTGCGCCGCCGACGCGACGGGCTGGACATGCTCTCCATTGACAACCGGCGGTGAGTCACGGGAGACGCAACCGAGTCGCGACGAGGCTTCGCGT
TGTGCTCGCTGTTCGGGTTGCTTTCGACGTGGTTGCCATTAAGATGCACAGCTTGATGGGCATCATGGTCGGTCTCCGTCTTGAGTCGCTTGCTGCTGGT
CTCTTCGTCCGCCTCTGGTGTCGCGTCTTCAaTAGGTCGCTTCTTATCGGTCGACAGATTCTCGTCGTGCTTGTCGCTGTCATCGTTGCGCCCATTCGTG
GTCTCCTCTACATCTTCTTGCTTGTGGTCTCCGTCCGCAGACGCCACGTCATTCTCCTTCGTCTCCTCCTGTTCGCTGTCGTCCAGTCGCGAGGGTGGCG
CCTGGgCCTTGGTCTCCGCCTTGTTCTCCTGTGCCTGACGGCGCTTCTTGCGCTTCTTCTTGCTCTGCTCCTGCGCGTGCGATGGCgACGCCTTcGGCTT
AATCGGGACCGCCTTCTTGGCCGCCATGGTGTCGATGTGATGCCACTTCTAAGTTGGCACCAAGTTGAAGAACTCCCGCCCTCCaCCAACCCACCAACCG
GAGAAACGGCAGAATCTGGTGTGGGCCACATCGTGTCGTAATGTTGCTGCATCGAAGGCAATGTTGCTGGTTCGAACTTGAAACCGTTGGACAGCCTGGC
TGCTTGGTTtACGAAGGTCTGAATTCCTGTCCGGGAAGGGTTACACCACGTGTACCCCTACACAACGGAACGATCCAGTTCATGTGGAAATTGAATCTGG
AGTTTTTtCCAaTCCGACGCGTGATCGGGTTCCCCTATTCCACCAATCAGGAGTCGCTCTTGCCAGCCCTGgCCCTTTTtGGCCGCGACTCGCGCCTAGG
GCTTtGGGGCAGCAACGATGCCCGGTGCCAGATGTGCCAGCGCAAGCGCGAGTCCTCTGCAGCGGTCTCCAGCATTGTCCTCGCGTCGACCGTGCGCGAG
TGGGCGGAAGCAGAAGCCGCCGACCCACGACCCCATCGAACGTGCGGCTGCAACCCCGCGGCATCCACAAGCCCGCGCCTCGTGTCTCTTGACGTCCATT
GTGCGACGAGTCCATCGTCCATCGTCCAGCGACCGGCGCGACGACACTTGCGCTTCCTACGCTCATCGGGCAACGGACAGACCCAACCCTTCCAGGCACC
ATGAGCGGCGGCGGCCACAACTACcGCAGTGGTTCGGTCATCGACATCATTGACATCGACGGCTCTGACCGGGCGCTACGCCTCGAGCCCATTCGCCCAA
GCGGCGTGGGGCTCGGCATGGGCGCGCTGCCCCCAGTGCCACATGGGTATGCGCGCAGCAACAGCCACGATCTATCGGGCGGCGTCATGGGCGGACGAAC
GAGACGCACATCACAGGACGAGATCCGCGCGCTGCTACAGCGCACGAGTATGGCGCTTGACAAGATCGTCAAGATCCGCGAGTCCATGGAGCCCCTGGTT
GACTTTAAGCAGTTCGAGAAGGGCGCGTCAAGAGGCGCCCAGGGCAGGACATTCTCGCGTGCGAGCTCGGGCATTGAAGACGCACCGATCGCTGATCAAC
AGCTGCGAATGCATTCGTCTGGCAGCTACGGAAGCATGCTGTCGGAAGATCAGTTAGGCGATCGCTCTACAGGATCCACCGAGTCGACGAGCTCGTCGGA
CGAAGCAGGTAGCTCCATGGGGCTGGATTCTAGCCGGGGAGAACTGGATGACCATCGTAGCAGTCGTAGCCATGGCTTAGGAGCCACGATTGAGGAGGAT
GACAGTGGGCTGTCGGACTCGGACGACGACGATGACGACACGTTCAAGGGCCCTGATCTTGCACCGATGAAAGAAGCACGTCTTGAGCGGCTCAAGAACA
TTACCATTGCGTTCCATGAAGGTCTCCCGACAGAGTTCTTCATGGCACTCTCACGCTTCTTGAACTCGTCCGTCGAGCTGAAGACACGTCACTCTAGATT
CAACTTCTACAAAGACACTTTCGTAGGAAGCGACGCCGTGCGTGATATGATTGTGACGGGTTTTGCTGAAGATCAGTCCGTGGCACTGCGCTACGGCAAC
GTACTTGTAAAGCTCGGATACATTGAGCATGTCTCTCGGACTGATGATCAACTTCACAACAACAAAGACAACTTTTACCGCTTCACGAGAGCCATCGACC
ATGAAGCCGCCGATTTCTTCCCCGATCCAGCGACACGTATGTCGATCAACGCAAACAACTACCGAGAGTCAGTTCTGTCGCGCGATTCAGCGGCAAGTAT
CGAGTATGATTTTAGTGAAGCTTCAGATGAAGCGCATGCTCTCGTGACGGATGAGGCATTGGCGATCTTGGCGCGTGTGCTTCACAAAGTGTTCGAGCGG
AAGAACAAACTGTTGTTTTACAAAGGATTCGTGGGTTGCTTCCTCGGTGCTGAGGCTGTAAACGTGATCCGCGAGTTGCGAATCGCGTCATCTCTAATCG
ACGCCGTGCTGATCGGACAAGCGCTACTAGACGAGAAGATTATCGAGCCAATTGCGACAAACGTGACGACATTCCAGGATCGATACGTCTTCTACCGCCT
GACCAGCGTGCAGGGATGAAGTTTAGAGCTGTTACAGCTTCATTTTGAAGTGGCCAAGTGTTGTGACGTCATAGGGTGATGATTAGAAACTCTCGTATGT
GGAAGAGCAATGCAGAGATGCTCTATGGAGAGACACAAAGCAGAGGAAGACGCGACGTAGCTAGTATGGTACCGAGTGTTTCTTGTGCGTATTTAATGAC
ATACTACGTGTTTCCAGAGAAACCGACACTTGACATGAAGATTGGTCAGAGAAGAGGGACTAGCAATGCATCACCACTTcTCCTGTCCTTAATGCTATCG
ATTATCCTCTTCAGGCATGAAAGCACATATCATCGCTGGTGACTCACGCAGACAAGTTTCGTCCGAGGAGACGGAACTGTAGTCCTCTCCGTCGCTGTGA
GCCTGAGCTGCCTCTCGGTCGTATGCCATCTCACTTCCGAATCCGCCATCCGAAGTTGAACGTTTAACCTTCCATCGAGGAACTGTCGGTATCGAATGGG
ATCGGTTAGAGCGCCCATGGTCGTCCGAGGCCTTGCCGTTTGTGACAACTGGTACGGAGCTACTTGAGCTGGCTTTCTTCTTCGCACATGCATCGTTTCG
CTTACGAATGCGAAGTTCCAGTTCCAATTCGATACCAACCAAGTATCGATGCAAGGCGTTGACGAATCGAGTTCGATACGACGGAGGGCTGATAATCGTC
GGgTTTCGGAACGTCAAGCTGGCCTTGGACGTTGACTCCAtCTTTTTCAGGAAATCAAACTGGTGTAAGTAGTCAATTAAaCCAACGACAACCTGGCGGT
TCTCTTCATCAAAGATCATGATCTACCATAAACGTGTCGTCAGAAAGGCTGAGATAGGTCCATGCATATGTCCAAGTGCTTACCAGGgAGTAATCAATAA
CCCCTGCTCGACTAAGGAAACCTGTGTCATTCTGAAACGCAGATTCAACCACATCGAGATCAGCCTTGCGGACAGGAATGGGAATCCTTTCAATGAGGTT
GCCATCCAGCAGCACTGGGAgATCATGGATCATTCGACGTGGAGCTTCGTCAGTAGGCGAATCACGATCTTCGTTGTCTGGACCAGTGAATCGACGGCGA
GTGATGCCCTTGATGTCGTATGTCTGGCCTGGTGGGAAGCCATACGAGATGTTCTCCATCACTACAATGTACGTTGTGTGTTTGTGAAGCCGTTTCGAGT
GGGTGAGCTTGTAGAGACCAAGAATCTTCGTGATCACAGTTGGAGTCTGGGTTTTCACGATCTTCGACATGAACTTGAAATAGTGAGGTGCCATGTGCAG
AAACATATTGAACTCGCTCACTGGAATCCCTTTCAACACATATCGCTTATCGTGTGTCTACGTCAAACATTTTGAGTAAGCCACCGAGTTCCAGTAAaCA
AGCAGTTACTACACGCACCATAGAAAaGAAAGCTCCGGATTTGCCCCCAGACGCCTCCCACCGTTTGCTTTGGGCGAGCGAACaCAAAAAGTCGACATTA
CCGTGCCCAGACAAAGCACGCAGTGCATGAAATTGCGACGCAAAAAAGGTGACACACCGGAACTCGTGCTTCGTGTCGAGGCTATGGTACATGAACTTGA
CTTCTGTGTGTTGTACATCGGCAGATCGAAGCTTGTTTAGGTAGAGAAGCTCTGTCGAAGAGGAAATACTCTGGGATAGACTCTTGACGCTTATCGACGA
AGGCGTCGAGAACTCCTCCGCTTTCAACTCTTGTGCAAGATCAATTGAGTTGTTGAAATGTGACTCGACAGCTTCAACGTAGGCCTTTGAGCATAGTGTG
AAAGAGATCAAGGACCCCAAGTCATACTCGTGAACGAGGAACACGTAGCCATTCACTCCGTCTGGTAACTCCATGTGGCCTTCACACAAAGCCTTCGGGT
ACGGCAAGAACGCCCTGATGGATACAGGTTCACTCATTCCGGCAAAGGTGGTCGTAAGAAGTACGGCAGATGTCGGCGTCGTCAGGAATGAGGTGCTATG
CGAGTCTAGGGAAGTGGTACTGAAGCGTTTGCGTTGCACAGAGGGTGGTCCAATAGATCCCGACGAATCGGTTGTCGAAATGTCGAATGCGCGGGCAGAA
ACAGGCAACGAGTGTCGAAAAGCCGTTCTATCTGCCTTTTCGTTTGTTGGACCCATGAACCAGTCGGTCGGAATCCGTCGCTTGGATGGGGACTCTGGAG
CAACCTTCTTCACTGTCGCTTGGCCTGCTGGAGGCGCGAAGGATAACGTTTTCTCGTTCAGACGGCGTACTTCCGTGTAGAGCTCTTTGCGAAGCATGTT
GCAATGGAGTACGTTCGCATGCTTTGAATTCATCAAAaGCTCGAGTCGACCGTTAAGAGCGATGATGCTGGTGTTCACGTCCGTTCGAAGCAGCTGCAAC
TCCTCTTGCGGCACTCGTGCGACTGCAGCGCCTAAAACTTGCTCAGCAATGCGAAGGTTATCCTCTAGGATGTTGATGTTGTCTTCCAGGAAATCTCTTG
TTGTCTCCAGCAAAGCAGAGAACTCTTCTTGAAAGCCCTTGAGATAGTCTCTCTTCCCTGCTGCGTCCATTGCGGTCTTTGAATACATTGTCGAAGCTAC
TAGCTTATATGGGCGCCATACTCTTCGCTTCGACTTTTTCTCACTGAGATCGCTCTGCGATGCCGAGGGAGGAAGTGCAAACGCTGATTGCGGCATCCAG
GGAGCGTATCCATCATCATTGGAAAGGGACGATCGCATTTTGCGAAATATGTTCGAGGTCGCGTTCCGCACACTGTTCATGCCATTGTGAACGCTGTCGG
AATCTTCAGCTGCGAGGAACGATGCTCGTTTGCGCACAATGAGCTCACTGAGAGCTGATAACCACTTTTCGCGGCTCCTCTCATCCACGGCATTGAGTCG
AAGTTTATGATGGTCGTTGATAACCAAGAACTGAAACTGGTTTGGGTTGGgCGATTTCTCGGGC