Description :
From Genome Similarity Track
Location :
contig_49:29015- 38111
Sequence
9096 bases(100 bases per row)
GTCCGACAGACACGAACGTGGAGCTCACGCCATGTAAGCGAAGCCCCTCCCCCCAGTATTCGTCATTTTCATAAAGGCTAATTCAATTGCAGTTCTTCCG
TCGGTCGTGTATGACAATTTGGATGGGGACAGGACGGCGAGTCTGGTGACTCCGAGCGGTGGAGTACTTGTCGCCCACGTCAACTACAGAACTGTAGGTT
ATCAGTTTGCTGACCAACCATGGCATTGGTATTAAAAACACCTAACGCATTGTTGTTTGCCATTACCACTCACACCAGGATGCTCGATATTACACGGAAA
ATGTACTCGAATCGCGACTAAAATACCCCAGTACGTATCTGGTTATTGCAATTGGAAATGTAGAACAGCAACTGACACACTCGAATGCTTTCCGTTTTGA
AGCTTCACTGAGTCCATACGCAAAGATCTCTTATGCGTCAAAACCATTCTCAGCAACAGCGTACAAAGCTGGGCAAGGGCCAACTTTTCTGAAAGACTTT
GACGCTGCCCCTGCACCCGTGGAAAGCGACGGGTTTTGTGAGCGAGAACTATCTGTACTGGGACCTTTATTGAACACTCAGAGCGATCTTTGCGGCAGAT
TCAAGCAGGTGGACACAAACGTGGGTTTTCTGATGCAAGTGGACTTTGTGGAGTCTAGCCCAGTTAATACAAGCTGGTCGTGGTATTTAGGTCTGCCCTT
TCGGCTCGGTAACGGCGCTGTCGTGGTCCTGGATGGTGTGGTGATGCAAGATTTGATGGGCAAGACTGGGTATTGGAAAGGTGTCCTCACGAAAACCACC
CAAGTTGACATGAAAATCACACCCGGTTTTCATGTGTTGAAGGTTTACGGATTATCTGCAAAGTTTGAAGCATCGAGTCTATATTTCAGTCGCGAAGGAT
CCAACCCGGTACTCGTTTCCACCGCTGCTCTCATTACGGAACTCACAAAATGGACTCCCTTTGCTGCTCCTGATTTTACGATATCAGCTACGCTTACGGC
TGAACAAGCTAACAAAGCTAGCAATGTTGGCAGAGGGGTATCAGTACTACAGTTCCAAAGTGCACCTGTTGACGGACGCTTCGCATTGCACTTAGCAGCG
CTATCGACGACAGATACCCCGAGTGCTAAGCTAAATACCTCGTCCTTAGTGTCCTTCTCGTTTCTTCCAACTTCGATGTGGGCTAGTGCAAGGGCATCTC
AAGTTTCTTTTGCTACAGCGGTTAGCACACTATGGAGTGCAATACCTGGCTTAAGTATGACCCTGACGCCTGCAACAAGTGGGGTTCTCATGTGTTCTTT
TACGGGAAGATTTTTCGTGGACAAAAGTACTGTGAAAACGTTTCGTCTCGACCTTGGGTTCGGCACAAGCACTACATCAGTCACCTCTCAGTTTCGCTTG
GATGAATCATTTATTGACCCTTCTGGTGTGCCTCTTGAATTTTCTTACTTTACTAGCGTTCCAACAGCCAGCGCACTGAGTATCTTGCTCAGTTATCAAT
ACCAAGGAACGAAGACTGGAAAGATTATAGGTAGCAGAACGACAGCCACATTTGTTCCAGGGGGTTCATTAGCTACTGAAACCTTGAGCGACAGCACGGC
TGCCTTGAATAGCACGATCTTCTCCAAAATGGTAGTACTCTCTTCCTCAAGCACATTGATAATTCGTGTTGGTGGTACCATCTGCCGCAATGCAGCCACC
GAAGTATTTCGTGCGCGCATATCGAAAAACGGAAACCCGATCTTTGATGGAGATTTCTCTTCAGTGGCGGGGACAGTGTTGTCAGGAATGTGTGAGCCTT
TGACAATGCACTCTATTATCGATTGTGTTGCAGGCTCCCACACAGTAACAGTTGACGTTAAAACATCGACGAGTTCTGGGTACCAGTTAAAAGGGGTGCA
ACTACAAATTGTCACGGTCGAGAGAGGTGCCTTGCTGTCGCAAGAAATGTGTCAGTCACGCTGTTCACGGCATGGTCTATGCCGAGTAGGCGTATACAAC
ATTGCTACGAAGGCATGCAACCTTTATATGACTCGCAATTCGTCCTCGTTAGTGACAGATCCAACTCGCGTGGCGTTTGTAAGAACCCAGGAAGTGGTTA
TTTCGGGGAATGCGTGGACGATTCTTCACAACACAAAGTGGGCACTTGGACAGAATGTATCTCTTGCAACCCCATGCAAAGGCGACGCGTGCGGAACTGG
TATTTGTTCTCAAACGTACACATTGAAAGAGCGCTGCCGATGCATTTGCCAATCAAGCAGTGACTGTGTAGGCTTCGCAAATACGGATGGAACATGTTAT
GCTATCACAGCATCAGACTTTCGCCAAAGTGTCCAATTGGGCACATATAATACCTCGGGTGCCGCTACTATTCATTTGAATATGCCTCAGACTTGCCACG
CTATCAAAGTCGATGCCCCAGATGCGGCAACTGGACGATATGTCATAGCGACGTCAGCAGGAATATATGATGCGTTTTGCAATATGACCGCTGATAGCGG
TGAGGGATACACGATTGTGCCGTGTGATTTGGGCATCAGTGACATCAATTGTCTGAGCAGTGCTAGCCCAAAAGACAGTGATAGTTGTAAGATCATGGGT
CTTCAACAAGTGGTACCGCGGTCTTCGGGGCATTTTATATCAATGCACCGAAAATATGGAGCACTCTTTTTCTCGACAGTTCCCGGAGTAACCAATGCCT
ACGTTGGCGATAGTATTGACCTACCAAGTGATGACGAAACTGTGCTCGATTGGACAGCAACCGATGGAGGAAAATGGTGGTTACGTGATAACGGTAGCAT
TTGTGATACTGTATCGCCTGCGAATGCACCAGACGAACGAAGGTGGATAGGCATGCATTCTGCTTTCAATGGCCAAAGTGTGTCAGACGGCTTATCTTTT
AGTTTTGATCCTCGTGGACTGGCAACGACTAGATACTTGTGTTCTACCAACGACGTTAGTCCATCAACCTCTTGGAGTGTCACTCTCCAAGACTCTTTTA
TTGGAAGCGGTGATGACAATCTCTGGGTAACTTCTTGGAGCGGTGCAGACAAGTGGTACCAGCTTTGTCAAGGAATCGTAATTCTTGGAGGTAGATCATT
CTCACGGGTCGGATCCTTTGTAAGGAAAACATTGAGCCCCATCAACAAGAGCGACAAACCATTTAACGCGCGCGTCAAATTCACATACTATTTTGTGTTT
GAACCACTTTACTGGGTAGCACTTCTTCTCAAGAGCTCTGAACCGAGGACTATTCGGGTTTACCTTGGTACCCAACTTGTTCGACAGCTGCAAGTTGATA
CCTCAGTGACCTATGCTTGCTACGGACAGAGTTCGACCTCAGCGCAACAGGCATACTTCTACCGTGGAAGGGAGCGATTTGCTGTGAGAGGATTTAGCGG
AGCAGCAAACGAACTACGTTTTGAAACGGATTTTGGTTCGTTGAACATCAGTGCCTTTGGGATTGACGAAGTTTCAATTGAGGTGGAATCATCGTTTAAG
ACACCTCTAGGACTATCGTTAGCAAATCCCGCGGTTTCATGCATGCACCTGAAGAGCGAGCGTGCTGCCAACGGTGATGTGAATCCAGATGGCCAGTACT
ATATTCAACTCGACCCAAATGTTGATCCAGTCCTTCTTCCTTGCTCTGACGGATGGATAGTTGCACAACGCCGTGTAAACGGCAAGACAACTTTCAATCG
CAATTGGAATGAGTATCGTGACGGGTTTGGTCTTGGTTCTGCCAATGAGTGGTGGATTGGAAATGATATTCTGGCTACTATCACAGCACGAGTCACCGAG
GCAATCATCGTCGTATCCAAAGATTATAAGGACACTTCCGCGTTTTATAGTGATTTTCGAGTGGCAAGCGAAAAGGAAAAATACTTATTGACTGTGCGAG
GGTACAATTCGACGGCGAGTTATGCAACGGATGCTCTTACCCCGCTTAGTAATATGTATTTCAGCACACCAGACCAGGATAATGATCTGTCCGCGAGTCA
AAATTGTGCGAGGCGAAGCCGGAGCGGATTCTGGTATGCAGACTGTCTTAGTGCAACTAGATCCGATTTAAACGCGCCATTTGACATGCTACCCATTTGC
ACATCCTACGCTGCATGGGCGCAAAGCTGGTGTCAGAAAACGGGGAGTATAGTATGGGATAACGTGGATGGTTATGACTCCTCAAAATTACTTTTACGGC
CGGACAGATGCCCACCAGGCTACACGAGTTCACAGAGTGGCGACTGTTCACAGTGTCCGGCGGGTACCTATTCAGAATCACACTCGAACGGATGTACGAT
GTGCCCTGCCGGGACGTATGGGCCGTCGGTTGGGTTGTCAGGTGTTGCAGCGTGCATATCGTGCCCATCAGGTTTCAAATGCTTAAGCGGTTCAACAACA
CCAGTTAAATGTTCTGTTGGCACCTTTGCTGACGCTGGATCAAGCGAATGTTTGAATGTCCCGGAGGGTTATGCGGGTCCATTTGATCAGATGGCTCGAA
GAGATTTCGTTCCTTGCACGAATGGAACTTTTTCGAAGCCAGGTCAACAAAATTGTAGCGCAATCCCCGCTGGTTTCTACTGCCCCTCCAGCGGGGCCCC
TTGTGCCTACACTGCGTTAGCGCCTTGCCCCTCTAGAAATGTGTACTGCCCAGAAGGAAACACTGGCCCTATCATTGTGCCACCTGGTTATTACTCTGTC
GGATCGATGGTGAATGAGCAACAATCTGGAATACTGTCCTGTCCAAGAGGGTATTATTGCCGACGAGGCACAGCATATCAGTGTCCACCTACTCGATTCG
GCGATCAAGTAGGTCTCATCAACTCACTTTGCTCTGGTCGATGCGCGCAAGGTTGTGTTTGTAAGGCTGGAAGCGTAAGCCGATGCCCAGATTCTCCCAG
TGGCGCTGACCAAGTAGTTTTGACTCCGTCATCAATCTCATATCTTCTCGCACCTTTATCGAAACAACCAGGTTCAACGGACGACGCCCTTACGCAAGGT
GTTTTTGCTGCTACAAGTAGTTCTGCGGCTGTTTCTATAGACGTTTTCGAGTTCAAAGATGTAAACCTGACTGCGTTTAAGACAGGGTGGTCTTCTGGGT
TTGCACACAACATATCGATTTCTTATTTCGAACATTCACAGACGGATATCACCTACGAGTTCAACTGCCCGTTGCTGGATTTGATTGGGGTGCTGTTGTA
CTGCTAGATGGGATTATCGCGGTTCCTCGCTCACGAAATGGTACATTCACATTTGCGTTTGTGTCATCGTCCGGGGCCCAACACTATTTGTCCATTATCG
CAGCTGAATCACAGTTTGTAGTCAAAAGAACAATTTTATTCCGAAAATCTACCGATGCAAGCTTTCGTAACTTGCGTTGCGATCGTTTCGACGGCCAGTC
TATCTCATTAGATATCGATATCGCGGTATGCGGAATTGCCGCCCCAACTTGCACGGGTAGTGTCTATGTCAACGGAGAAACTGTGAAAACTATAGCAGAT
ACAGCAAATATCTTACATATTTTAGTGTACTCGGCACTTGGCACGAAGATGTTTGACACTACTGTTGACGCTACGATGTCTAATAATTATATGCCCACGT
TATCTGCGATGGGTGCTGGGGATATTGCTGTTCTCATTGGTACAAGTATCGTGAAAATTCCGTCGAGTTTGAGTACCTGGATAACCGGGTACGGCATATC
TCAGATTAGTACTAACTCTACAGCCTCGGGCTTTTTGTTCGTTGGCGTCAATGACAGTACTACTCCAGCGACGTTCGAGGTAGTCACCCCAGGATCACGT
TACAACTTGCAGATGGCACTCCCGCTATCACAAGCAATCTCGTATTACAATGCTATCAATGTCCCAGCGGGTTACTATTCTATTCCGGAGGGTTCTGTGA
ATGATCGCCGATTCGAATACAAAAGGTGTCCCACGGGCTATAGTTGCTCAGGTGGTGCTCGTAAGCTGTCGTTTGTGTTCCCAGATTCGATTTGTGTCGA
CAGAAATCACATTCTGAGCATCCACGAAAATGACCCTGGATTTGTCTCGGATGTCAGTTTTAGCCTCGCATCTTCTTCAATCGGTATGACGTATAACCTC
CAGACATCGACCACTTCTACAAACCTTTTCAAACTGAACGAGCAGAAACATTTAATCCTGATAAAGGCATTAGACTACGAGAATCAAAACGCATACGAAA
TAACACTCATGATCCAAGAGACCTCAGCGAGTGCACCGTTTGCGGCGTGTAAAATCCATGTGAATGTGGTAGACGTCAATGAGGCACCCATCATTAGCGG
CTACCAGTTTGCTCGAGCATTGAAGGAAAATACTCTACCTCCCGCAACTCTCATGCCTGCTGTTGGTGTCATTGATCCAGATGCATACGACACGCATACC
TTATCTATATCTAGTGGTGGGAATGGCAACTTTGTCATTACTCGGGATGGTAATATCGTTGCGATCAACGCTATTGACTATGAAAGTACAACGGAATTCG
TATTGGATGTTGTTGCAAAGGACGGTGGTGGCTTGGAATCTCACGCTAACGTGGTTATCGTGATCCAAGATATGCCAGAGCCACCAAGTTGTGTATCCTT
TTCATTTAATGTGGCTGAAAATACCTCGATTGAGACTGGGTTGCACAGTTGAGTGGGTACGCATTCGACCCCGATTCCGGCGACCATCTGATATGTGAAG
TATTATCTCAAATCCCGATAGGAACAGTTGATGTGGATTCTTCCACTGGTAAAGTGACGTTGAAAAAACATCTCAACTACGAAGTCCAGGACACCGTGCC
CTTCACGTTCGTTTTACGGATAAAACGGGGCTTCAAACAGTGTGTGATTATCGCATCGCTGTGACAGACTCAAATGATGCTCCAGTTCTAACAAGTGCTG
TTTTTCGCGTTCCGAAAACTGCATCGGGAACACGTGCTTGGTAGGAAATCTAGGTACTTTTGCTGTTGATGAGGACAAAGGTGCAGTCCTGACATTTCAA
TTAACGTCCACGAGCGACTTTCTGTTTGTTCAAGGTTCTCAGTTATGGTCAAAACCGATGGATTTTGAAACGAATCCTGCAATTCAGATATCAGTTACAG
TTTATGATGAAAAAGGCAGCAGCGATGAGGCAACAATGACTGTGCAGGTTGTTGATGTAAATGAAGCTCCTACTGGATCACCCTTTACGAAACAAGTGGC
AGAGAATGTTCCTGTCGGAACTGTGATTTTAGCGTTCGACGCAGTCGACCCAGAAGGCGATAATATCAGGTATACAATTGTTCATTCAGTTGGCAAATTT
GGGGAGCTTTTTGGTATCAACGGTAGTTTCCTGGTGACAATAGCTGAACTTGATTATGAGGCGTTATCGATTCATTCGCTTGGGGCCAACATCAGTGCCT
GCGATCCATTCGGCATGTGCGCCGAGATTGGTCCAAATCTTGTCGAAATTACAGATGGTCCCGATGCGCCTGTTGTGAACCGAGTCGTAGATGGCGTTAC
CATTCCCGAAACCACACCTGTTGGGGCATCCTTGACTCAATATGTTTGTTTTCAGATGAAGACACCGGCCAATCGACAAAACTTGTGTACTCAATACACT
CCGGTAATCCGCTTGACCAATTCACTATTTCTGAATCTACGGGGAAGCTGACTGTGAATTCACAACTGAATGCTGAAATTGTCAGCGAATACTCATTCGT
TATTCAAGCCACTGACCCAGATGGGCTTAGTGGGCTCTCTCATCCAATTGATATCGCTGTCAAAATGATACCCTCACCCCCACAGTTTGTTGGGGCTATT
ACAGCGCAGAGTTATTATCATGTTGACATTAGTCAACTAGGGGATGGTTCTTATGCTACCGTGTCCTTACCAATACATGACAGAGATCCGGGACAGATTG
GAGGAAAATGCTCCATCTCGGCGGACTCAACTGATAATTTCAAGATTGTAACCAGCAGCGACACCACGTCATGCGAACTATCTGTGCGGCCAGCGCGTAT
GTACCTGACGATCAACGCGTTAACATCACATTGCGTGTAACGGACACAGTGAATTCATCTGCGTATAGTGAAGTGACAATCGGTGTGCTATCACGAAATA
TTAATCATCCACCTAAGTGCACCAATGCGCACACTCAATTGATCGAGAATGTGCCTTACGGTACAGCTGTTGGTACTGTCATAGGAAGTGACTCAGATGC
AATCGATACGGTTTCATTTTACATTGCAGCTGGAGATGATGATGACGTATTTCAAATAGATTCGTCGAGTGGGGCTATCACAGTGGGCACGAAGGCTCCT
GATTATGAGAAAAAGGCGCTATATTCGCTAACGATTCGGGTTCGAGATGACGCCGCAACCCCACTCGCTGGCACGTGCACATTATTATCGATATTTTGAA
TGAATTGGAGTCTCCCGTTTGCTCGTTAGGTATCTTTGTTAGCGCTCCCGAAAATAAAATCAGAGACACGTATGTGGGAGACGCTATCTGGAAATACTGT
ACAGACCCAGATACAGGGCGGAGTGACTCGACATCATTCATCTTCGAACTTGTAGATAGCAGTGTTACTTTTCGGGTTGAGTCCTTTACAGGTCAGATTT
CAGCAATTGAAGTGCTCGATTTTGAAGAACGTCCCACCTACAACTTAACGCTTATTGTCAGAAATGCATTTCGGCCGGCGAAGAGCTCATTTGTGACGTT
AAACATTGAGGTGATCGATACCAATGATCCGCCCCAGGCTTCATTCCTCGCTTCATTTCCTAGCCTGACAACGATGAACGTAGACATTCCTGAATCATCT
ACGGTGGGTACAGTAATTGGTGAAGTAGTTGTTTTCGATGAAGACGCTGGTGATGTTTGCACAGTGCAGATATCAGACCCCTCTTCAACGTTCGCACTGG
AGCAGATAAATTCCACAGTCTATAACGTTAAACTGGTAAAGCCTCTGGATTATGAGACTCGGTCGTCTTATCCAATAGATATATCAGTATCGGATCAGGC
TGAAGCTGGAACGCTGCTGTCGTTGCGTGCTGCTGTAACGGATCTTAACGAAGCTCCCTACTTTGAAGCAAATCAGCATTTTTTCATTGACGAAAA