Description :
From Genome Similarity Track
Location :
Scaffold_44:290076- 292062
Transcript NameFunction/comments
Phyra_79952putative GPI anchor protein
Phyra_49059deoxycytidylate deaminase

Sequence
1986 bases(100 bases per row)
CGTACACAGGCGTGAACTGCGGTGGCCCCGGCTCGTACGACCAGGTGACGGACATCGGCTCGTGCACCAAGTCGTCGGTGACGACGACGAGCCCCGTGTC
GCCTCTGGACTCTGGAGTCACGCTCGCCTTCCGTGGCCCCATGACCATCTCGAACATTGCGGTGTTCGACGGCAACAACGGCACGTGGAGCAAGGTGTCG
TCGTACGAGAACGGCGGTGCCGCCACCAACATGGTCTTCCTCAACAACGAGAACGTCGACTACACGGGTGCCGGCTCGCCTGAGGGCTTCTGCGAGGCCA
ACGGCGCTGGTGTCGCCCAGCAGTCCACGCCGTTCACCGGCACGCTGGCGGCGGCCACCAACCCGAAGAGTGGTGCTATCCTCGCTTCGGAGGCCACGGG
TGCTGAGGTGCACATCATGACGGAGAACCAGTGCGGTGTGGACGTCGAGTGCGAGGGCGCCTACGACACGGACGGCACGGCCTTCCAGGGCTGGACCGGA
GGCAAGAAGATCTTCGTCACGAAGGTGTCGATGGAGAACGGCGGATCGCCCGATGTCCCTGCTATTTGGATGCTGCCTGACCAGGTGACCCACTCGGGCC
AGTACGGCTGCAACTGCCGTGGCGTCGGCCCTGCCGGTGGCTGCGGTGAGCTTGACATCGCCGAGGTGCTGGAGAAGGACACGAGCTTCGTGGCCACGCA
CTTCTACTTCTACGACGGAACGTACAACCCGGGTAACGACCAGTTCGCCCAGCGCCCGACGTCTGGCCCGGCCACCTACGTGACCATCGTCGACCAGGAC
TACGGTGTCAAGGTGCTCGCGATCGGCGCGGACGACTTCGACTTCAGCTGCGGCTCCATTACGGACGACGTTGTGTCGCAGTGGGAGGCCGCCGAGTAAA
CTCGTTGTTGAGTTCCTCTTTTTGTGTATAGCCTCAACAAGCTTTAAGCTGTCACGTTCCCCGATCGCAGGGCGGATTGCAATAGAGTTGTTTGACGTCG
GAACATCTCTCTCTTGTATTATGATTGTCTATTTGCTGTCGCGTGATGGCGGCCATGAAACGTGGACAAACAAACGCTCCTTTTATTGGACCGACGTGAA
GTCGATCACGACCTTGGCACTCTGCAACTTGTGCTGCGAGTACTTCACACCGGCCATGTCCAAGAGCCGGCGAGATGCCACGAACTTCCAACTGCAAGTG
AGTCAACAAACCGTTTAGAGATCAAGCCATCATCTTTGCATCTTCCAGTGAGCACACATACTCGTGATTGTATTTGTCGGAGCAGTACACGACCCGCGAG
ATGCCACTCTGCATAAACACAACCGAGTTAGACGAATATCTGAAGTAACTGCACACATGACACTTCAGTACCTGGATAATGAGCTTGGCACATTCATTGC
AAGGGAATAGCGCCACGTAAATCTGCACGAGCACGCAACAGTGAGATTGGGCAGCAACCTACAACCCACATCAAAACCCAAATATTCGTACAGTGCATCC
TTTCACGTCAGTGGAGTTCTTGTTCAGGATGGCGTTCATTTCTGCATGACAAACATACTGTGCAAAATGAAATTAGCCATGGATCTGGCAGGAAGACGGT
GCCCCCACCACTCCTACGTACCGGGTACTTGGTATCCAGCGGCGAATCGGTCGCGCTCTCACGCGCCCATGGCAACTCGTCGTCGCCACAACCATTTGGA
AATCCGTTGTAGCCGATGCCCACAATCTTGCGCTCAGGGCTCACAATACTAAGGCCCACAGCACCTCGTCAGTCTAACATTCTCTACACCCAAACAGTGC
GCAACCTCACCATGCACCCACTTGCGTCGAAGGGTCTACCCACCCACAAAAAACAAAACTTCATCAGGACACCTTTTTTCAACTCGCTCAAAAGTACCAA
CCTTTCGAGCGCATGGCACTAAGGAACGCGACGCTCATGAAATAGTCATCCCACGACAAATAGTCGGAACGTTTCTGCACTGGCGC