Description :
From Genome Similarity Track
Location :
Scaffold_8:290058- 292929
Sequence
2871 bases(100 bases per row)
CTGGAGACTGGAGGTTGGTAACGATCCACCAGCTTGAGTTCCTCCTCTAAAAATCCGGCTAAAACCTGGTGCAGCTCCTACCGGTGCAAAGTACGCCAAT
ACAGCCCGGAAAAATCAGAATTTCTCGATGCTTTTAACAAGAAGCTTGTCGAATTGGGGTGGGTTTATGAAAACCGTGAGAGCCGCTGGTGCTGCCAGCC
TTACCAGTTAAAAAGCTTAGCACTGATGACTACCGACAAACAGGTGGATTATAGATCGACAAATGATCTTACCGAGCCTATCGCTGGTGTGATGCCGAGT
CTTGAGGTGGCGTTGGAACACTGTAGAGGAATGATGTACTACGCGATGTTTGACTTCCTCAAGGGCTTTTGGCAGTTCTCGTGTAATGGGAGCTGCCGTG
AATTTCTCTCGTACATGACCGACCGCGGCGTGTTCACGCCAACTCGGATTCCACAAGGAAGCACCGACGCTGCCCTACACTTCCAATCGACGGTGGAAAT
GGTTTTAGGTGATTTGGTGAGCACGAATGTCTTCGTGTGGATCGATGACCTCCTCGTCTTTGCCAAAAACGCTGATAAATTGGTTGAAATTATTGATGCC
GTACTTCAGCGGCTGGACGAGTTTGTATTTATCCTAAATCCAAAGAAGTGCTCTTTGTTTCAAACTGAGGTCTACTGGTGTGGCCGCATCGTCAACAAGG
ATGGAATCGGTCATGACCCGAGTCGCAGCCAGGCCTTAAACGATATACCACCGCCAACGACCGCCGCCGAGCTGCAGCAATATCTCTGCGCCACCAATTG
GATGCGCGCGATCTAGTTGACTACGCTCGTGTCGCAAGGCCATTACAGGAACGTCTCGAAGCAGCCTTGGTCGGCACTAGAAAAGCAAGAGAGCTGCAGC
AGGGGTGCCAATCGCCTTGACAGTGGAGGAATTGAAACGTTTCGATGCAGTAAGGGACTTGTTGGCACATTCGGCGACGTTATCATACCCAGATCCAACC
AATCATGAGTTGCTGGTCTGTATGGGAGGCAGGTTTACTGGATCAGCTCTTAACTGGAGTGTTATCGAAAAGGAATCCTTCCCGATCGTTCAAGCGTGTG
AACGACTGGAATATCTATTGCTTTGACCACAAGGGTTCAAACTATACTGCGATCATCGGAACATCGTCTACCTTTTCGCTCCCGGCAAAGAGTTAAAGAA
ACATGTGCGCGGGAAGCTCTTACGCTGGTCCACTAAACTATTAGAGTACCGATACTCTATAGAGCATGTTGAGGGGATTCACAACGTGTGGACGGACCTG
ATATCGAGGTGGGACGGCAAACCCCTACCAAGAGCGCGTATTTACTCGGCCAAGAGGTTTACACGAGCCAATCGCAAGCGTGGAAGCGGTTCAAAGGCGA
GTCCAGCTCCTTCGCCGCTACGCCCACTAGACCAGGACGGTTTCGTCTGGCCTACAGTCGAGGAGATTGGTAGCGTGCAATCACTGCACGACGCACCGAA
GGGTGCAACACGGAATGGTGATGAACTATGGCTTATGAATGACGTGATTTGGATACCAAATGGAGCTCACGACTTGACTCAAAGACTTCTCGTCGTCGCT
TACTGTGGTAGAAACGGACACCGCGGCATGCATGTGATGGAAAACCACATACGCCGGCTGTTTTACATTTCTGGCCTCACAAGGATTGTACGTGACTTCT
GCTCGAAATGCCTACTCTGCCTACATGTGAAGGGAGGGGTAGTGATCCCCCGACCTTTTAGTGAAACTCACTACACCTACGAACGGAACGAGACGCTACA
CTGGAATGTTTTGACTCTGGGTGATTCTTTCGGCACCTCCCGCTACACGCTCGTGTTGAAAGATGAGGCAACACACTTTACGGAACTGGTGGCTTGTGAT
AGCCCTACTTCTGAAGTTGCAGCAAGTACCATCCTGGATTGGTACAGTCGCTTTGGAGCGCCTAGGGTGTGGGTCAGCGACTCTGGATCGCACTTTAAAA
GCAAGGTGGTATCAGAACTTGACCGAAGGCTGAAAAGTCGGTAAGAGCTCGTGGTAGTATACTCTCCTTGGAAGAACGGCTCAGTAGAGCGTGTGAACCG
GGACATCCTGCAAGTACCGAGGGCACTGGCACTGACGTACAAAGTTAGCTTGCACGATTGGCCTTACTTACTTCCGCTGGTGCAGTCCAGCCTAAATCAC
TCCCCTGTACCGTCGCTGGCTAACCGGGCTCCAGTTGAGCTATTTACGGGACTACCATGCCCCAGTGCACTAGACACGGTATTTTTCCGGGAGGAAAGGG
TGTAACCACGCTGGACAATCCAAAGTCAAGTACAATAGAGCGACTCAACAAACTTCGAAAAAACATTCGCAACATGCACAAGCTCGTCAAGGACGAGCGA
CAACGCCAGAACAAACGGTACCGGCTACGACCACACCACGAGCAGCTTATAAACTGATCTGTCGGTGATTACGTCCTACGTTCTCGTGTCGATGAGAAGC
TTCATGCAAACAAGCTACGTGTGATGTGGGCCGGTCCGTACCGTGTGGTTGGCAGTGCTGACTACTATTTCACTGTGGAACATTTGGTCAATGGAAAAAG
AATGGACGTACATCCATCTCGCCTAAACCTGTATGCTGACGACTCGCTCAATGAGACTGAGGAGCTTCTCGATCATATTGCCTCTCAAGGGACACTGCTG
GCTGTAGATGCGATCGTAGATCATCGACTGAACGCAGACATGCAGGCCTATGAGGTGAAGGTAAAGTGGCTTGGTCTCGAGCCTATCGAGGACTCCTGAG
AGCCCTTGAAGACCATGAATGAAGATGTGCCACAGCTTGTGCTACAGTACGCCACTGATACCGGCGATGAC