Description :
From Genome Similarity Track
Location :
Scaffold_483:29003- 30239
Transcript NameFunction/comments
Phyta_totarag8699hypothetical protein PHYSODRAFT_323073

Sequence
1236 bases(100 bases per row)
AAGCAGTCACCTTGTAGCTGTTATTGAAGAGCTTATCGCCTCAAACAGGGCCGTGGCTGCGCGTCTAACTATCGTCGAGGCTGCGCTACTGAAGACTAAA
GGAATACAAGCAagaagtgaagaagcacaagcacaagacgCGTCAGAGCAAGAACCAAAACCCAAGCGCAGAAAAAAGCAAGCTACGAACCTGTCCGTAG
CGTGGCACGAATGGTACACGCGAGTGCCGCGCGTCTGGGACTCCACCGACCGTCAGAAGAAGTCCGAGTCCCGCCACGTCGTtgccttcatgaagctgtt
catcGATGGCGGCTTCATCCTCGACTCCAACGCGGAGGGCTACAAGAGCCAAGTCCTCGACGTTGGTCGCcgcgctgaagctgccacgaTCGCGTTTCTG
AAGACCCGTGGCGTCAACTCAAAGGGAGCTGGAACCATTTTTGCATAAAACTAACGGTGCACTCGGGTTTCCCAAATTTGCACTCGAAAAATAACTCGTT
CCTAACGAGGTTGATGGCCACCAGCGTACATAAGTAGCGCACTACTAAACGCTCACTTGGACGACTGATTTTGCGCTGCCAAACGCTTCACCAAAGACTT
TAAACAGTCAATTGATTGCTCGAAATCGTACAGTACCAGCGCGTTAGAGCAATGGATGTAGTTTCAAACTGTAAACGAAATGGCACCACCAGTGTATACT
TTTGATCTTCCTCCTCTACGACACTCCACACCGGCAACGAGCTCTGCGTTTAGCATCTACTCCGGATCCAGCCCAACGCCAGCGTTTTCATTTGATCCAC
TGCACAACAAGTAGCACATCAGCACCACTAATACACATTCTAGTACTTGAAGAGAGTACAGTGCTGGCCAAAAGAATAGCACACCCTAGATTTGCCCGCG
TAACTCAGTCAATATTTTGACTTTTGTGTCCAGAATTGGACCAATTAGagcgtttttttttcacGCTGATTCTGCCAATCAATTGTGAGCTCAATCGCGG
CAATATTGACAGACTTTCTGTAAGAGGTTTCTACAAGAGGTTGTCCAAAAGGATAGCACACTTTTAACTACTTGAATTTTGTATGTAAATTATGTACACA
TTATGTATAGAATCGCCGATTAGACTGAAGTGACGCTAAAGCTAGCGTGCGACCACGCTGTGTGTCTCTGAAAGTGAGCCGCGGCTGTGGCAACTATCAC
TTAGAGTATCCCAAGATACTTAGTCTAGTATAGCAG