Description :
From Genome Similarity Track
Location :
Scaffold_6:290027- 291601
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_02428Hypothetical protein
Sappa_CBS223.65SPRG_02429Hypothetical protein

Sequence
1574 bases(100 bases per row)
GTGCGCACGAACTCATCGACGGACGAGTGCAGCGGAAAACTGATGTGGGCGAGCTCCTCTTCACCGCGCTGACGGACGTCCGTGGGGTACATGCGGCCAA
AGCCGTAGTGGAGACCGGCGACGAGCAAGTTGAGGACCGATAGGATGACGCGGCACATGGTGGTCGCGAGGAGACCGAGGCGTAGCTTGTTGGACACTTC
GCCGCCAATGTACACGAGACCGCGCGGCTCTTGCTTGAACTGGCCTTGGAGCTGGATCCAAAAGAGGCGGCGGCGACCGAGAAAGAGCTGCTGCCACTTG
GGCGGCGCGGGCTGCGTCTGAAGGAGGAAGAGCACCTTGCCCTTGAAGAACTCGTTCTCAAACTCAAGCGGCGTGTCAGCGTTGGGAACGATGGCTTGGC
CGCGCTGGAGCTCGACCTTGTCGCCAGTCGGCAGCACCATGTCGAAGATGTTGAGCGACGGCGCGTGCCAAGCTTGCTTCTCCATTCTCCGCCAAATTGC
ACTTTGCGGCCTTTCGGGTGCCAGATCCTCGGCTTCTCTCGCCTTCGCCCTCTATTTTTAGCATGCGCGCACCAATGAAATCGTCGCATTTCCACATGGC
GCATAATTTAGCCAATCCGCATCGAGAGGTGAAATTCAAGAAATTTGGGGATTTGCCGCCGCCGACGACTTCGGTGGAAGGATCCGGCGCGAGGACGTCC
TCCGCTGTCTTCAAGTTGCACGTGAAGACGAGATCGTCAGCGTAGCGAATACAATACCTTGAAGGCTCTGATGGTTATAGACTGTTCCGCGCACCATATA
GTAAGTCCTGCAGCCGCAGGATTCGAGGAGCAAGGCGTTGAAGGCAACCATTGGCTTCGTCAAGTGCACCTTTTTCCCACCTTTTTCCTAGGTCTGTTCT
CTCTTTGAGCTTCAACGTACATGTATCGCGCTTGCGAGTGAATGTTTTACCATAAGTTTAACGTTGGATGGTTCGTCGAGTGTCCAAGCTTCAAGGCTTT
ATCTGTCTATGAGGTTGATCGTTGCATGAGCTCACGCGGTTGATCCAGTCGCCACGGACGAGTCGTTGGCTGGACGCAGGACTCGGGTGATACCATCTCG
TGAGCCAACGCGAACCGCACGTTTCGTTTGACCTCGTGCACCGACACACCAGCTGGTTGCGCCATGCGACGCCGCTGTATCTCCACAGAATGAAACCACA
GAAATGCCAACGCAACGGCAGCGAAACACAGTCGATCGTATCCTCGGCCATAATGCTGGACGTCCAGCGAAGGGGATCTCGATATTCATTGCTGGATCGA
CCCCAGCGTCGACAACAACGACTAGGTTAAACGACTGGTTTTTGGTCCCTTGTTGCCTGCACGCAAGAACCACTTCTCATGGTGCTGTCAACCCGACAGT
TGGTTGTTAGTTTCCTTCTCGCAATGTCAGCCGAGCATCAAATCCAATGCAAAATACGTCGCATTCTTTAACGCAATATTTGGGCCACAGCATTTCCTGC
TAAAGGATCCACTCTTCGAGGTACGGTGCGTCGGCCTTGGCCTTGGCGACGCTGCGCGTCGTGCGCGGGATCGG