Description :
From Genome Similarity Track
Location :
Scaffold_5:2900- 10900
Transcript NameFunction/comments
Physo_379827Hypothetical protein
Physo_334425Hypothetical protein

Sequence
8000 bases(100 bases per row)
CTTATTCTATGGTTTACGTAAATTAAGCTAAATTGGGGCGCAAAGGACCCTGGATGAATGATTCTTAGACGGAAATTGTCGGACAATTGGCAGACAGAGC
AAATCGTGATTTGTTTAGAGAATCTTACGGTAATGTGGTTGTGGTGTGTACTTGAACAGCACGAAGAGAGCATGGGGAGACTTGCCAATGCGTGTATCGT
AAGCTGGCTTGATATCTATTTGAAAAGGCGGAACTCACACTAATCTAAATTGTTTTGTGGTTTTTCCGCATCAGTTTGGCTACGGTGGCCCAGCTCAACT
GGCCGCACCGACGTTTTCGCGAGTGTGCGGTTTCTCGGTCCACTGCAACGCTCTCAGCACAGTCGAGGTATACTTGCGCTCGATGTGCGTCATCAGGTAC
CTAAGCTCGCTCAGTCGCTTTTGAAGCTTGCGGTCTGGCATATCACGTCCGTCGAGCAAGCGCAGCGGCGGCTCTTGCTTGGACTTATTGCCGCATCTCC
ACAGCACCCAGATGTGATGAACAGAGCAGTCAGGTATCTCGAAATCTTCGGCTACGCGACAAAACTTCCCACCCCAAAAATGCGCAGGCGTGCGCTCGAA
GTCGTTATCGAGCTGCTCTGTGAGGTGCTCTGGAGGTGCTGCCAGCTTCTGCAGAAGCTCGTCAACGGCGCAATCTTTAACACACGCCGTTATAGCTTCA
TTGAGCCCATCGTAGGTTACAGTTCCCGCACCAATCGCTCGTTTTCAAGCTCAGCAATAATATCCTTCGCTGTATCCACCCGTGTCGCTTCAATTTTGGT
GAGGGCACCGACCAAGTTTTCCATCAGCCACTTCATCTCGCACAAAATGGACACGTGTGGCGGCACGCCAGTTGAACAAATGCGAGCTTCGGAGCTCCCG
TCACCTGACTGCACTCGCTCGGCAAGAGATGACAGCAGGGCTGGATCTTGAAATAGTGGCGTTTCGAGAACGGGATGCTTCGGTGATATTGCACGTACCA
AGTATGCGTGATGGTAAGTCAGCGAGGCTAAGCAATACTCAGCGATTAACTTTAACCCTTCGGGTAGTCCAGGGAACATAAAGCGGACACCTTGCTGAAC
ACCTTCGTCATCCACATTGAAGTGGGGCGGAAGTGTTGAGAACTTGTAGCTTTCCGTAGGCAGCCCAGCCACTGCCCGACCAACGTGCATTTCACCCGCA
GCTTCGTAGCGTAGATAGGTGTTTTGGACGCCGCCAAGCGACCAACCAGCTCTCAAATGCACCGCGGTCGACGACGGTCATGCCGTCGAGCCCGAAGAGC
AAAATGTAGCGGAACCTCTCCGCATTGAGTGCGTACCCAGCTCTCTAGGATTAAGCCCTTGGCGCTTTAATTCGGCGACAATACCTTCCTCAGCTAGCAA
ACGCTAAAAGCACTTCCGAAACCGCTCGTACTGATTGTTGCCCGGGAAAAGAAGGTCGCTTGAATCAAATGATGTCGACGCCCAGTATAATCCCAGCGCA
ACAATGGGGCAAATAGAAGGCTGGAGCGGGTTTGCGTAAATGTACCGAGGATCCCTTGGATGTTCACCGCCTTGGTCGTTCTTCATGTGCGCGAAGTACA
TCTGAAGTGCATCGCCTCTGCATTCCATATGCGAGTGTCGGATCCCAAAGGCATTGGACGAGCGACGCATGAGATTCCAGGCAATGACCATGTATGCATG
AGAAAACGCCATCTCCTTGCCAGGAAGAGTAAGCATTTTGCCACACAAAAAGCTGTATAAATCAAACATCAGCGGGTCTTTGCCTGTCTTGATCTCGCTG
GCTCCGATGGACGCATCCTTAGCTAGCTTGTGCTTTAGCCCCTTGAAGTAGGTGGTCAACTCCGACTCGAGCGTCTTGCTCATGGTATGACCGAAGTCCC
GAAACAGGTTGAACAAGCTTGCTCTGTGCGTGTTGAGAACAGAGTAGCTGAGTGCACCGCCGTCTTTACGCTGGAGTGTGATCAGCCAGGTGACGAAGAC
CTCCGCGTCCAGGAGCTCGAAGACGAAAGGGTCGATGCGCGGCTTCTGGTTGATCACCTCCTTGATATGCGCCCGTAGCTGTTGGAGGGAGTACGCGGCA
ATGTCTCCAAGACGGGTTGCAAACTCCGGTGCGACGAGATCGGCTTTATTCTTGGCAAGCCACGCGAGAAAGCGACAGTAGGAGTTCTGATAGGTGGTTC
GGGAGCGAGCTGTGACTGTGTTCTCGCGAATCTGGCGGACCTGGTCTTTTAAATGCCCCCAATCGTAGCCCTCCATTTGCGGTTGTACTTGTGTCCGACG
TCTTCTGTGCTAATCGAGAATTGCGATCGTCGCCACACGTTTACACAGGGGGCAAAAACTCGTTTTTCAGAAAATGTTGGACGATGTGTCCGACTCTTTA
CCGTGAACGCCTAAAATAAAGCGCCCCGAGGACCCTAAAGGACCCTGGGATGAACGTTCATCCGGGTCGTAATATATATAGGGTCCAACAAATCAACAAA
AGTCAAATCGTTAGGGTCACTAATCCAACGATGCGGCGAGTTCATGCGATTCTTACGCTTCGGCTTCGCTAACTGGCAAGTCTCACACATGGGTAACTCT
CGTTTCTTCGGCATCATAACGTCAACGATGCTCTTGTACGACATTGACTTTAGGTATTGAGTATTCGTGTGCCCAAGTCGGGCGTGCCAAACACGAATAT
CAGCTAGCCCATCCATCTTCGTGAAGTTCACGACTTCTGTAGCGCGCATCGCCTGCCGAGAGCCATCCTCCGTAACCGAGTTGTAACTACGGAAGCTCTA
CACGTTGTTCGGCTGCAGCGTTGCAGCCAACAGAAACCTATCACCGTCATACACGTTGTACGCGCCCGAACCCGGATCCTGCACCTCTGTGAGACCCTGG
TCTCTCACAATTCCTGCCGAAAACAAATTCCATCGAGCGCTCGGAACTTATAACACCCGATCCAAAGTAAACTTCTTCATCTCACCATTTTCTGACTTCG
TTACTAGTTCAGCAACACCAACATCGACTGCATGTGTCAGCATATTTTGTGCAAACCCAGCTTAGTTTAAATTAGAGTTAATTATACTCGGGCCTCCGAG
TATAGATTAATCTTAATAAAAGATCCAAATAATGTTTTTGGGTTAAAATGAGAACTGCTATTTTTGTTTTATGTTTCTGACTTCCTCTAAATGTAATATT
CTAAACTGAGAATCTGTCAACGGCTGGTTGGCGGAATTCCAATGCTATGCATGTCGCTCATTGGCTAAAAGATGCTGCTTTCAGCCAATAGGAATCCTAA
GTCTCTATGGACCACCCGTCGTGGTGATCGTAAATGTATGTAGCATTTGGTGTATCTACACCAAGGACGAGAAAGTCTTTCGAACCTCTAACAGAGGGGG
CTGCGAGTTGCGGAGCAGGGGCCAGAAATGCCGTTTTACGCCGGCAAAAGGGACCGCCGCGAAAACATGTCTGGGCCCTCTCATATCGAGGTTGTAGCGG
ACGTAGATGATCACGCAGGTGATTTAGCTGGTCATAGTGCTATGAAGTGTAACAGGGTTACACGCACAAGTGGCTACAGTCACTTGTAACTCTAACAGAC
ACGGCCCCTCCTGCTAAATCGGAGCCCTCCAGCGAATCGGGCCCGATGTATCGGATCTTGGACCACCCGATTTGCCAAAACGGATGAAAGCCACAATACT
AGCGTAGCGAACACGCTCTAAGAGCATCTCCACCGGTCAACAAAAATTTTGGCAATAGAGGATGTTAGCAAATTGGTATTTTACGAGTTGGAGACAAAGA
CACTCTACCACCGCTCTCTATGTTCCCGAACTCGTAAGAGGGGAGTCGTGTTAGTACGGAATCTCCCGAGAAACTCGTAAGGCTTTTTCGCGAGACTACA
AGCCTTCTGATTGGCTCGTTACTCCCATCCTGCATCTCCCCCTTGAGCACCATGGCCGCCATGGCGCTTACAGGTACATGTAGCACCGCGACTCGAATCG
AGTCGCGGTGGTTCGAGTCACTCGAACCACCTCATCCAGTCTCAAGTGCCCCCCCCCCCCCTAATCCGTGTGACGTCCTTGCCTCTCCCAGCGAGGCACA
CAAGGATGACGACGATTCGACTGCGCGTCTAAAGTCATAACGGCGCGTCGAAGTAGAGTAGGCAGCCATTGACCACAAAGAGCAGCATAAAGTAGAATAT
GTTGCTTAGAGTAGTGATGTCCGAGTTCCTGATCGTACTATTCGTTTGGGTATGTCAATCTAAGAAGCTGCATGGCGCCTCGATACTGTAGCGTTTGATT
CTATCGCGGGTGATGACGTCGAGAAATGTAGCGCTGCGCTGAGCGCGCGAATCTCATCCTCGGTGAAGCTGAAGTACCTCTTGCAGTACGCATCGCTGTG
CTCGTTGAGCCTCGAACTCCTGGGATGATCAGTCACTCGGGGCTCTCAGAGCGCGAAGCAGCATCGCAGGAGGGGAGGGGGGGGTCTGAGTGTCGGTCCG
TTAGGTGGTTCTGCGGCGAGGTGAGTCCAGCTAGTTCGGCACCACAGCAGCGGAGTTTTGAACCGTGAGCACGGGGGGGTTGGCTGCTGCAGCGACCGAA
AAAGCTGAACTGAGGACCGCGACACCGCTCGTAGGTGGTGGTCGTACGAGCGCTCTGTAGTGCAGACCACTCATCATTTGCACCGCGTTTTCATACAACT
TTTCTTAGGATTACTCGGAGAAATTAATTTTGTGGCAACGTTGGGTGCCGATGGTCGATCAATATCTAGTATACATCATTCAATGCGGAAATTTACATAC
AAGTTTTCTTATGATTACTCGGAGAAATTATTGTGCTTCGCAATGATTTTGCCGACCATTTTAGACGCTAAATATGGCAAAGCCTGCTCCTATATATGTG
TGAAAGAAGATACACGACTTGCTAAAATTATGCATAAATCCACCTCCTCATATATATATCGACTTGGGAGGGCCTGTCAGCAGCCATAGACACACGGCAA
TTATGCATAAGAGGTTGGATGTGCTGAGGATCATGGACGGTGGTGTACTGGGCCAATCAGAGGTCGCAAACGGCCAGCCGTGGCCGTACGGATAGTTTTT
GGCCGTGGCCGCGGCTGTCCGGCCGGACACCACGGCCGGCTGCGGATAACCGAGATTCATTGCGATATCAACTTTAGCTGTTCTAGCTTCGATTGTTATA
GCCAAAAGGACTGCTCTTGACGTTGACAATGAGTATTGTGGCTAAAGGAAGCGGTATTGAGTCCTCCAGCGTTGAATAATATTCGTATCACCAGTCAAAT
GTAGAAATAGCTTGGTACGAAAAAAAATAAGCTGTTTTACGGCCAACCGAAGCCAAAATGCCGGCCAGCCACGGCTGGTCGAATGAAATCCACGGACAGC
CGAATCATGCCTCGAGGTTGGCACGGCCAGATACGGACAACCGGTTTTCAGCATTTGCGACCTCTGGGGCCAATGCAGGTGCTTGTGGATAAAAGTCGAC
AGAATTGCAGCTGCACAGGCACAATTGCACTTTCAAAAGTGCAATTGTGGTGCTTTTAGCGTAATTCTAGGCCTCCACCAATTTATGCACCTCGATTTAT
CGTAAATCTAGCAGGTGGTCGCTATAAATACAGCAAATCTCGTCTGATATTGCCAAAATCACAATAATTTTGCGGCAACGTTAGTGCGAAGCAGGCGCAG
CAGATGCGTATCAAATGTTGGCAAGTTATGTTCATTTAACCGAACAATTTTGGTTTGCTTCGACGAAATTGCATATTCAGGCGCACTACCAGCCCAATCC
TCTAGTTAGAGGATGTTAGCAACTTCGTAAATAACGACTCAAATTTACGGTCAACATTTTTATGTGTTTAGTTAAAACGAAATCGTCGATAGTGTTAGCA
TTCTCGTATCCGCCCATTTTCGAAATCCAACTGACTCCCAGCGATAGAGGCCGCCCTGCTGACACGAGATCCCTGCATCCGACGCCGCGCTACCTACCGT
GCCTCGCTTCATCATCCTCTCGCCTTTGTGCATTCTATCTTAGCCGCATACTGCTGAATGTGTATTAGACTTAAGCATTATTCTATCTTGGTCGCAGCGC
GCCAAACATCCTCCGCGCTTTTGTAGATAGATCAAATATTGCTGCACAAACTACTTGCATAGCAACTAGAAAACCGGGTTGCCCGCTATCGGCAAATACC
CTCTCCTCCTTCATTCAAACATTTCAGAGCTGGCACCTTCGTACTTAACGTTTACTCTTAAGCTCTGGAAACCAATATCCTACTGAAGTAGTTTGCCACT
CCACCGAAAAAGCCTCTGCTTTACGTGAATTTCAAGAAACCATGCGATTTCTGAGATTGTTAAATGACTTTACTTGATTTCAGTATAATTTTACTTCATG
TGCGCCACATATCAGGTGCATCGAATTAATCCTGGTTGGGCTGTCCATACCGTGCAGGTTCGGACAAATTCATGTCCGAAAATTAGGCTCGGACAATTCT
ATAATTTGATATATTATTTTTAACAGTGATAATGTGGCACACTGAAAAATACCACAAAGCAAAAAGGCAAGTGGTGACTCTCGGTCTCGGGGAGATGCTC
GGTCTCTGGCAGCAGCAGGAGTTGCAGGAAGGACGATGGCGGTGTGGATAGCTTATTGGCGTCGGGCGGGGCGTCCGCTGCTGGTAGGGCCCTCAGGGCC
AGCAGCTGGACGAGCAGGATGAAGACGAGGACGCCGTGCAGGATGGCGGCTGAGTGAAGGAGGGGGAGAACAGGCTGGACGGCAACGAGGCAGCAGCTCG
AGCAGGAGAAGGGCGTGATGCAGGACAGCAGGGCGGACGAGTAGGTTGCGGTGTTGCCGACGCCGGAGCTGGTGTCGGCAGCCACGGCGGCGGTGACATT
GCTGGCGGAGGCGGTGCAGGAGATGGAGTCGACGGAGCTGCTCACGTTGAAGTTGGCAGCAGCGTCGGTGCTGGCGGCGTTGGTGTAGGTGATGGTGTTG
GCGGTGAAGTTGGCTCAAGACCCGGACGCGCAGCAGCAGGAGCAGGAGCAGGAGCAGGACATGCGGCTGTGGTCTCGGGGGGAGGCCTTCTGGTCTATCC
GCGGCTGTACAAGCTGGGCGGTGGCGTGGGTTTGGACTGCAGCTGCGTCCCCGGTCCAGTACGGCGGAAGCAGCAGCACCTCGATGAGGTGGACGGCGGC
GCGCCGGTGCTGCAGGACGCGTAGAAGTCCTGCAGACTCTGGACGAGACGGCGATGGCGCGACAGATGCAGGCCCGCGAGATGGAGCTGCCCTTGCTGCA
GGAGGAGGGCGGGCCTGTCGACGCGGCCGCGCTGAGCGAAGAAGGAAGGAGCAGCAGGCCGCCGAACCAGACGAAGAAGTTAAGGAGGGGCAAGCCGACG
TGGAAGCGATTGGCGCTGGCCTGCGGACTGATGGGGAAGGACGACCATCAACTCAAGCGCTCCCAGCGATCTCCGCGGGGCAGATGCTGCAGAAGCTGCG
CGTCGAGAAGAAACGCTGAGGGGAGACATCGCCGTACCAGAAGAGCTGGAGGAAAGCGGAGACGGCCAAGCGTTCAAGGACCAGCGATACCGCGAAAGGA
GAAGCGAAAATTGAGAGAGGTAGCACGCAGTATTACAGTTAAATAAATATTTATTATATTTAGCGGATGGACATTGTTTTTCTGCAGAGTTGTGCTCGAG
GAGCATTGAGACCGGAAGACGTGAACGCTCTTCTGATGGCGACCTTCCTGCATTGCAAGATCCCTGTTCAAATCGATATCTGTCCGAACGAGCACGGTAT
TTTTAAAATATGAGATTGTCTTGCTTTCACTAAGATCATATCAAATATTTGTTTTAGGATCGGACAAAATATGTCCGAATTGTCCGATTTGTTACTAACA
GCCCAACATGACCTTTGGAGCACTCCCATTTGTCCAAACAGTACGACAAAGGCTTCTGATAGGTGAATTGCTAGTGTCATATTGCAATGCAAAAATTGGT