Description :
From Genome Similarity Track
Location :
Scaffold_370:290- 2370
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_370-snap-gene-0.6ATP-dependent chaperone ClpB

Sequence
2080 bases(100 bases per row)
GTGTGAGttATGAGTCTGCTGCTGTCTCGAGCGCGATGGCTGCGCCCGCAGCACCGGCTTCTGGTGGCTCGGACCTTTGCCAGCATGGGCTCCAACCAGC
CGTGGATCAACCCCGAGAACGTtCcGCGTGGCGAGAGTCTCAAGAAGTTCGGaCGCGACCTCACAGAGGACGCTAAGAACGGCAAGCTGGACCCCGTGAT
CGGACGCGAGGAGCAGATCCGCCGCGCGGTGCAGATTCTCTCGCGTCGAACCAAGAACAATCCAGTGCTAATTGGTGAACCGGGCGTGGGCAAGACCGCC
ATTGCAGAGGGCCTGGCACAGCGCATTGCGCTTGGTGAGGTGCCTGAAAGCATCAAGAACAAGCGCGTCGTGTCCCTCGATCTGGCGGCTCTTGTGGCTG
GTGCTAAGTTTCGAGGCGAGTTCGAGGAGCGACTGAAAGCAGTGTTGAAGGACGTGGATGAGACGCAGGGCGAAGTCATCTTGTTCATTGATGAGTTGCA
CACGCTCGTGGGTGCCGGTGGAGGCGAGGGATCGGTGGATGCAGCAAaCATGCTAAAGCCGGCACTTGCGAGAGGCAGCCTCCATTGTATGGGCGCCACG
ACGTTGGACGAATACCGTAAGTGaGtGTTGTCAATCTGCTACTCCGTGTGACGACtcACTGTGGTTCCATGATGACGCGTAGGCAAGTAcATTGAAAAGG
aTGCAGCTCTTGCCCGTcGCTTTCAGTCCGTTCTGGTGCCAGAGCCAACTGTGGAAGATACGATCACGATTCTGCGCGGACTCAAGGAGAAGTACGAGGT
GCACCATGGCGTGCGGATTTCGGACAGTGCGCTTGTGTCTGCTGCTACGCTTGCGAACCGCTACTTAACAGAGCGGAAGATGCCAGACAAGGCGATCGAT
CTGGTTGATGAAGCAGCGTCACGATTGCGGCTGCAGCAAGAGAGCAAACCGGAGCCGATTGACAAGTTGGATCGCGAGATTATCTTGCGTCGCATTGAGA
TCGAAGCTTTGCGCAAAGAGAAAGACGCAGCAAGCAAGAAAAGAATgaCAGCgCTGGAGCAGGAAGTGggaGAATTGGACAAGGAGTTGCGCGTGCTTAT
GGATGAGTGGCGAGCCGAGAAAGACCGCCTCGAgtACATGAAAGAAGCAAAGAGGAAGCTTGAGGAGGCTCGTCGCGAGCTCGTGACTGCGCAAAACAAC
GGCAACTATGGTCGCGCTGGCGagTTGCTTCACGCTATCATCCCGAAGTTAGAGCAGCTAGTGGCTCAAGAGGAGAGCGATGAGGTTTTGtCTGCcGAAG
CTCAGGGCGAGGAAGATGAAGACAAGAAAGCGAAGTTGAGGAAGACCCATCTCGGAGATGCTGTTACCGCAGACCAtGTAGCGGAGGTTGTAGCCCAAGC
AACAGGTATCCCAGCATCGACACTGATGGCTGGCGAGAAGAAACGACTTCTGAAGATGGAAGAGTACTTGGACCAGCGAGTTGTGGGTCAAGACGAGGCT
GTGAAGGCTGTCAGCAATTGTGTGCGTCTTGCACGGGCTGGCTTGCACGCCCaCAACCGCCCACTTGGCGTCTTTATGTTCCTTGGTCCGACTGGTGTGG
GTAAGACGGAACTCACAAAGGCTCTTTCTGAGTTTCTCTTCCAATCTCAAAATGCGCTCACACGCATTGACATGTCTGAGTACATGGAGAAGTTTAGTGT
GAGTCGCCTTGTGGgtGCACCACCTGGATACGTGGGCTACGAAGAAGGTGGCACTTTGACTGAAGCTGTGCGACGTCGTCCTTACCAAGTCGTTCTGTTT
GATGAGTTTGAGAAGGCCCACCGTGATGTCTCGAACATTCTGCTTCAAGTACTGGACGAAGGTCGCCTCACAGATTCACAGGGCCGACTGATCGATTTCC
GCAACACAGTCATCATTCTCACCAGTAACCTGGGATCGGATGTGCTTGCATCTCTCCCGGAAGGGGAGCCGAGCTCTCGGGCCGAGTCGGATGTTCTCAG
TGTGGTTCGTGGTCACTATGCCCCCGAGTTTCTCAATCGAATCGACGAAATCGTGCTCTTTAACCGTTTGAAGCGCAAGG