Description :
From Genome Similarity Track
Location :
scaffold_1046:290- 1804
Sequence
1514 bases(100 bases per row)
AAAAATCCAGCATCAAAACCTGCTGGGCAGTGCCGCGAGCAAGCCAAACATGCCGCAACGGATCATTTAACACTTGCATTCGCGTGATGGTGACGAGTCT
GCCAAAACTGAAGATTGAAGGGAAAGCGCGGTACATTTTTTCGATTAAACACTCGTGCAGATGTTGGGAAACCTTCTTCCTCGTACGGCGTTGCACTAAA
TTCGTACGGCACTGCACGTAGCCAATCTCCCAGGCTTCCAGTTGTCTATTGGTAGCCAGATTTGCCTCTGGGATGTTTCTTGGACGCTCGAAAGCGAGTT
TGGGGACTTCCACTTCACTTCTTGTGGTACGTTTCCGGTGTTGCTTGGGATGCTTCTTGGATCCAAGGTGGACCCATTTACTTAGCCATTAGTTATCCAA
GAAGATGATGTTCGTCGCATCTGATGTACATAAACTACCAGTATTGACACGTCGTGGACTGCGGGATGTCCAACCTGTCCGTACAGCAACCAAGGCAATT
GCCAAGTATCTGGCTACAGCGACATGGCCGTACGATGAAGACTGTGCTCCGTACCGCACACTTCATCCGGTGGGCGATTTCCCGTTGTAGTCTGTTCGAG
GCAGCTCTCTCACTTGTCCACTCTATGGTGAGCACAGCGCAGCACTTGATCCGGGATTGTCGATTTTTGGCTGCTAGGAAAGACGATTGTTGGCTGCGCT
CAGTTGCCATGAGCGCTCAGTTGCCATGAATGTGTGAAGAACAACGGACTCCTCCTGCGCCGTACATGCTCCTTATCAATCGCATAACGTCAAGACATCA
AACGCAATACTGCACCATTCAAATGAAAATGTTCGTACATCGTCACTTACCCACTTCAACTTACATTAAGTATCACGTCAAGTTCTAAGTGGTCACCTTT
GGATGCACTTGACACCCACTGTGACGGTGGATAAGATTATCACCTGCTTGAAGACCTGAAGCTTGGCTAGGCGCACGCACAAGATCTACGTGTGGTGGAT
CGATCGAAGCACCACGAGATAATGGGCGAAGCTCGCACGCATGAAGAGCACCTGTGGCAGAGAGCCACACAGACACATGGATCCCTGGGCTGCTGGAGAT
ATAGCAGGCGATGTCAAGAGATAGTTAACCTAGCTAAGTTAGTCTCAGTTTACAATTTGCTTCCAAACGTTGACCGTTGGTGGGAGTCCCAGCTCCCAAT
TCCTGAGTGACACGTCACACCCACAGCTCCAGCGAACTACCTTCTGTACCAGGAAGACCCACTAAGTCTGAGCGTCAACGATCCAAATACAATGTTTTGC
CGCCCAGCGCGGTGGTGGTTGTTGTCCAGGTCGCGGTTCCACCCGCAGAAACTGACACCTTGTCGATCTTTTCTCCTCCGGAGTGGATGTTCACTTTCAC
ATCCTTAGTGTCACCGCTGGAAAATGTAATAATGACTGCACCATCGCCCACCCCTTTTCCAGTTACTCGTGCTGCCGTTGAAAGCCATCTCAATAGTATT
CAATCCGAGTAGTG