Description :
From Genome Similarity Track
Location :
Scaffold_2879:290- 1419
Sequence
1129 bases(100 bases per row)
ACAAGCACATTAAGACTGTTGAATGTGGGAGCTCTGTGACACATGCATTGTACTGGGCCTTTTCTGCATCCATCATGACGTATTGAGATGCGAACGGAGC
TCCACAAGTATCCACACAAACACGCTTAATGTAGCGAATACACCAACCGATACCCAGCTTGCGCTTTTGCGATGTACAGAAGTAGGCTAACGGCAAAAAG
TGGCAGCTCTGATCGGAGTATCCAAATGCAAACACCGAGTACCCGTGGATAGCCATACTGTGTGTACTGTCCAAGTGCAGAATAGTCGTGCAGTCGCCGC
GACTCTGTACGGCAATATAATCTCGGATTTGCCGAAGACATGTCATACCAACACGGAAAGGGTACGCTTCTGAGCCGTCACCTAAGTGAGATACAATACC
AGTGCTGTCAGGCCGTGCATCCGGCTGCGTGTCACAAAGGATCATCATGTCAGAGTCTGGCAATGACACCAAATCTTGCTGTTCGTATAGGTGCCCATCA
CAAATTTCGATCATTGGGGCCATCAAGTTCTTAGGGTTGTTCCGCCTCCAATTTTTTACGAagtcgacgacttgctggtCTTTAGCGGAGGTCCACAAAT
TCCCCCTTCATGCACCATACTATAGATAACGGCAAATAGCCGCGCCGCTGTTGTCTTCACGCCAGTTCTTAGTCGCTCCACAATGAATGCCTTCATTTCA
GGGGTCAATTTTCGCTCAGAAGGGCTGGATGACCCGTCATTGTCCACTAAATGACTGGCGTGTTGAAAGACCTCGCACGCCCCGGATGATAGGCAAACTT
TGAACTTGTATCGGCATGGACAGGGCACGTTTGTATCGACATCTGAGTCAGCGTCTTCTACCCGTCGAGGATTGCaacgacgagagcgacacTTTGCTAA
CTGAACTCTCATGAGGTGTACAGAGGCAGCAAGAGCATAGTCTTTGTCAAATAAATGGTCGATTGTGCAGGTAGTTGGGTCACTCTTGGTTATGCTGTGC
GACGGGAGTAATTGTCGGTAGGGGTCAAGCGCTTCTGGGGTCGCCGTCGATTTCCAGATTTTTGTCCACCTTGGACTGCCACGGGTTTGGACCTCATCCG
CGCTGTCGGAATCCGACGACATCGGCCAC