Description :
From Genome Similarity Track
Location :
Scaffold_2084:29- 4047
Transcript NameFunction/comments
Phypl_g14652hypothetical protein PHYSODRAFT_517932
Phypl_g14653Amino Acid/Auxin Permease (AAAP) Family

Sequence
4018 bases(100 bases per row)
ACCGCAGCTTCCACCTCCTCAATCACTTCCGGATTTGCCAGCTTCCGCTCAAGTCCACCGCCACCTCAACCTAAGGCTACTCACTCCGTCGGCACCATCA
CCGCTCAAGCCATCATGCCGCGCAAAGCTTTCTTCAccgccgaggacgccaaggcggcgttcaacctcttctgctgcgtctaCGGCATTGGAACGCTTGG
TATGCCCGGTAACTTCTCGCGCGCCGGCCCCTTCATCGCGGTCATTGCTATGGCCTTCATGGCCTTCGCCAACGTCTACGGCGCGGTAGCCATCTGCCGT
GTCATGCTCCTCGCGCCCACGTCCGTCAAGACCTACGGTGACCTCGGAGAATGGTGCATGGGCAAGCCCGGCCGCTACCTCTCGGTTGTCTCTCAAATGG
CCAACTGTCTGCTGGTGCCATGCGTGTTCCTCGTGCTTGGCGGCACGCTCCTGGATGGCCTCTTCCCGGAAGCcttcagctccacgacgtggaTCATCCT
CATGGCGCTCTCCTGTATGCCCGTATGCCTGGTTCCCACTCTTAAGGagggagctggcgctgctttCGCCGGCTGCATGGGCACCATCATCACGGATgtc
atcggcgtcgccgtcgtgaTGCACGGCATGCGTGGCCACCCGACCATTCCCAAACCCGACCTCACCTTCAAGCAAGTCGCTGGTGCTTTCGGCAACTTGG
CCCTTGCGTACGGCGCCGGTATCGTGATTCCGGCgcttcagcgccagcacagTGATCCCACGCGCATGCCCCGTGTGGTGGGAGTCACGATGACGTTCAT
CTCGgttctcttcctcgtcttggccagcactGCCTACTCAGCCATCGGCTGTCAGATCTCGGGCAACCTCCTATACGCCATCTACCCGGACGCGGAGACT
GGTCTGACCACGCTGGGCTTTGCATCTGACTGGGGCATGGTCGTCCTTGCCTACCTCTTCATGCAGCTCCACATCACgatcgccttctccgtcaTTCTGA
ACCCGGCCTTCTACATCGCCGAGCGCATCGTGCTTGGAATGCACAAGCCTGCCGTCGCAGACGTCGAGAACAACCTATTGAACTACGGGGACATGTCCAC
GCCCGCCGATGTTGCTGAGCGCTCGGAGAAGCAGTCGCACACTTCGCGTGCCTCAAAGCGTCGCTCGTTCATCTCTGTCGCCGACAACGAAAATGTGCAC
CTCGGCGACccggaggcggaggctgccGAGTACCGTGGCGCCAACGCTATCAAGTATGTCATCCTGCGCCTCATTATGATCACGATCCTGGTGATCGCAT
CGGTCATCCTGAAGGACCACTTTCACGACTTGGCCGACTTCGCGGGTGCCTCGTGCATCACGGTGAACTCGATCATCCTGCCAatcgtgttcctgctgaa
gaagaagtggaacGTCATGCCGATCTGGGAGAAGGCCCCGGCGCTTACCGTAGTCGTGGTGTGCTTCTGCCTGGGCTGCTACGTGACGTACACGTCGGGC
AAGAACCTGTTCGCtcccagcgacgacgacgcgtccttCCCCTACTGCGCGCCGGAGTTTGAGAACACCGTGTACTACAATTACACGGCGGAGCACGAGA
ACTAGGCAGTTAGCTGCTCGGCGATGTAATGGAATCTGATCATGTTTGAAAAACGTATCGACTGCTGGTGTTGATGAAGTCTTGATGGTGAAGTAACCTT
CTCGTACTATaatactacgtagtattgtgctttgcagactTTTTGTCACTTACGCAGGtaattcgtacgaattaACGAGTCCAACTTATCTATAAATCGT
ACTTGAGTATGAATTGCTGTAAATCGTGCATGCTGTACTCATACCAATACTGCGCGCAGGTCATCTAATCACGAGCGACAGATCTAATATGAATTAATAC
CCGTTTGGCACTTTCAGAAAGTTCCATTTTCCGGCTATAACGTGCTTCAAACACGACTTCGGGAGTTAATTCTCAAATCCTCTATGATATAACACTAAGT
ACGAGTAGTAACTATTATAGTGCACTAAATagcaggacaaactggttgcaaagcacaatacatgtGGCATGTAAATCCGGGTAACCCTATTATAGAAGGA
GGATCTGCGGTGATACAACAAACGTGTTGTATTGGTATATTGTTTCAAACTAACTGTAAAACGCTCATGTGACTGCAAGATCGCTATGACAACAATTTAG
TTCTCGTGCTCCGCCGTGTAGTTGTAGTACACGGTGTTCTCAAACTCCGGCGCGCAGTAGGGGaaggacgcgtcgtcgtcgctgggaGCGAACAGGTTCT
TGCCCGACGTGTACGTCACGTAGCAGCCCAGGCAGAAGCACACCACGACTACGGTAAGCGCCGGGGCCTTCTCCCAGATCGGCATGACgttccacttctt
cttcagcaggaacacgatTGGCAGGATGATCGAGTTCACCGTGATGCACGACGAGCCGACAAAATCCGACAGGTCCGAAAAGTGGTCCTTCAGAAGCACC
GATGCGATCACCAAGATCACGATAATCACAATACGAAGAATAACGTACTTGATGGTGTTGGCACCACGGTACTCGGCGGCTTCCGCGTCAGGCTCACCGA
GATGCACGTTCTCGTTGTCGGCGACAGAGATGAATGAGCGCTTGGAAGCACGGGACTCCTTCTCCGAGTGCTCAGCAACATCAGCAGGAGTAGCAGCATC
GGCGTAACTCAGCAAGTTGCTCTCGACGTCAGCAACGGCAGGCTTGTGCATCCCAAGCACGAGGCGCTCAGTAATATAGAAGGCCGGGTTCAGAAtgacg
gagaaggcgatAGTGATGTGCAGCTGCATGAAGAGATACGCGAGGACGACAGCACCCCAGTCCGATGCGAAGCCTAGTGTGGTCAAGCCAGTCTCCGAGT
CCGGGTAGATCGACCACAGCAAGTTGCCAGAGATCTGGCAGCCAACCGCCGAGTACGCCGTACTCGCAAGAACCAGGAAACAGCACGAGATGAACGCGAT
GGTCACGCCCACCACACGAGGCATGCGAGTAGGGTCGCTGTGCTGACGCTGAAGCGCTGGAATCACGATACCGGCGCCGTACGCAAGGGCCAAGTTGCCG
AAAGCACCAGCGACTTGCTTGAAGGTGAGGTCGGGCGAAGGCACACTCGAGTGGCCGCGCATGCCGTACATCACAACAGCGACACCGATAATATCCGCGA
TGAGTGTTCCCATGCAAccggcgaaggcggcgccagctccttccttGAGAGTCGGAACCAGGCACACAGGCAGGCAGGAGAGCGCCATGAGGATGAtcca
cgtcgtggagctgaagGCTTCCGGGAAGAGGCCATCCAGGAGCGTGCCGCCAAGCACGAGGAACACGCATGGCACCAACAGGCAGTTGGCCATTTGAGAG
ACAACCGAGAGGTAGCGGCCGGGCTTGCCCATGCACCATTCTCCGAGGTCACCGTAGGTCTTGACGGAACGCGGAGCGATCAGCATGACACGGCAGATAG
CCACCGAGGAGTACGTGTTGGCGAAGGCCATAAAGGCCATGGCGATGATTGCGATCACGGGGCCGGCACGGGAAAAGTTACCGGGCATACCAAGCGTTCC
AATGCCAtagacgcagcagaagaggttgaacgccgccttggcgtcTTCGAGCGTGAAGAGAGCAGAGTGCGCCATGGAGAGTCGGTTAGGTTGGTCGGTT
GAGGCGCAGGGGGAAAATCGGAGACTGAGCTTCAATGAGGTGGGCGACGACACCTTCTCGGCCCCAGCTCAACGAACCGGTCAACTAGCGAAGTTCTCAG
GCGATATTCGCACAAACGGAGCGGAATGCGCAAGCTTAGCCAACGCAGTGAACCCTGCTGCGAGCAAGAGCCCGGCCGCTATCAGCCGTGCCGGCGACGT
CAGATCGCGATGGGCCTATGAGCGCGCCCAACCCCCCAGCAAATCCCTAGCACCGCACTTTCTGGTGCGGCGTTAAACGCTGCCGCACCGGCACTCGCAC
CACGACACCGGATTCTGT