Description :
From Genome Similarity Track
Location :
Scaffold_2378:29- 2888
Sequence
2859 bases(100 bases per row)
TCGGTGGATCCCAGTTCAACACGCATTCGTGGAACTGAGGAACAGGATCGCGACCTCGCCTATCCTCCGTCATTTCGATCCGGAACGTCAACCTACGGTA
ATAGTTTATGCCAGTGACTGGGCAGTCTCAGCAGCTCTGGTGCAAGAACATGAGGGGATCTGTCATCCAGTCACCTTTGTCAGCCGGACACTGAAGCCGA
ATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTTGCGCTCCTGCGCGTGTTGGATCTAAATTATAACCTGCTAGTGGGAAGATCCATCCGGATCCT
GACTCGACACTCCACGCTAGCCTGGCTGTTCAAGTCGGCCGGGTTGCAAGGACGTTTGGGACAGTGGGCAGCTTTACTCTCACCTTGGACGCTGGAGATT
GTGAAATGTTCGAAAGGGGAAGACGAGATCCTGGGAGTCTTGGCCGCGAGCATCACACCTCGAGCTAAGATGGATGAGGCGCTGACTAGGATCGCCCCTA
AGAAAGAGCCCAAACGCCGGATCCAGATCCCGATCCCGACGGTACAGGTGGATGAGGATCTATACGTCCTGAGTTTCGATGGATCCGCTCGTGTACGACG
CGGAGGAGGAGCATACAGTGCAATACTGTGGAGATTGCCCGGATGGGATGTTGTACGGGCCAGATCCACTTACGCGGAAGGGCTCACCGTCAATGAAGCG
GAGTATAACGGACTCCTTCTGGGTTTGGATTTACTAAAGGGACAGATCCAAAACGGCTGGTGATTTGTGGGGAGATAAATTTGGTGATCAGACAGGTGCG
AGGTGAGATTGACTGCAAGGCCCCGGCCCTAACACTGTTACGGCAGAAAGTGATGATCCACCTGCGCGGTTGGATGAATCACGAGTTGGTGCATGTCAAG
CGAGATTGGAATGCCAGTGCAGATAGCTTGGCCAGCGCCGCTTTACGGAATCAATGTGGTGTTGAAGTGGAGAGAGAGGCCGAGCATCAGGATCTTGTTA
CGTTGAACCGACTAGAATGAGTGGTGGTAGTGGGGTCCGGGAAAAGGACAGTCCAGGTGATGGCCGTCACTAGGTCCAGAGGAAGGATTGGATCCAACCC
CCAAATTCTCGAGGAAACATTTGTGAAGAGAGTCCGCATCGAGCGGATCCTCAAAGCACAGAACGAGGAAGCGTGGATCCTAGGACTAAAGAAGTATCTG
ATGGGGTATGTACGAGACCTGAGTCGGGAAGATGCCAAATCCTATAGCATTATCGCTACGGATTACGCGGTGGATCTGAATGATCCTGCTCTTCTATTGC
CCCCCCCCCCTACGAAGAGAGTCAACGAGGATCGGGCTGGATTGATGAGACTGGTGATGCCGAAAACCTTACAACAGGATGTCCTACACCACTATCACGC
TAGCTTGGAAGGCGGACATCAGGGTATTGGTCGGACCTACTAACGGATCCGGGAATGTTTTCACTGGAGGGGACTATTCAAGAGCGTACAACAGTATGTC
GGGGAATGTGTGGATTGTGAGACAGGCAAGGGCAGACCCACAATCGAAGGGGAGTCACCTGGGAATATCCAAGCGACTTACCCTTTCCAAGTCATAGCCA
TGGATCATATCCCCTCGTTGCCCAAGTCGTTCAAAGGAAACACAGAATTGTTGATTTGGGTGGACTTGTTTACCGGATACGTGGTAGCCAAAGCTAGTGC
GTCTAGAACTGCGCAGACCATTGCTGAATCGTACGAGGAGTGCGTTTTCCGAAGATTTGGAGCTAGCGAGATGATTAGACATGATCGGGAGCCAGGCTTT
ATGTCTGATTTCTTTCGAGCATTCAACCGGATCTCGGGGCAGCGACAGCGAGCAACCATGGCATATCGTCCCCAAGCTAACGGGTCGGCCGAGCGCATGG
TACAGACGATCACGAGAGCACTCAAGATGTACGTCCAGGATTTGGATCAGAGGGATTGGGATGAGTACGCAGAACGGCTCCCCTTCGTGATGAACACCGC
CCAAGACAGAATCCGGGGTGATACCCCATTTTACTTGGTACATGGGTGGAATCCCCAATTCCCCCTGGAGAGCGACCTTCCCATTTGGGCCACCCCCCAG
AAAGAGAAACCGAGATTCCAAGAGCGAGGGGCGATACCACATTTCACAAAAATACTTCCCCGGCAAGGCTAGATCCCAGGTGAACGAACGACTGCGGAGT
GCGATACAGGATCAAGCGGATCGACACAACGAAGACGCCCGTCCACATCAAATCCAAGTGGGATCGTAGGTGTGGCTTTATTTGGATCGAGTGAAAGAAG
GGTACGCCCACAAATTGGCCCATCTATGGCATGGACCGTTCCGGGTGAGCGAGAAGATTGGAGAACACGCGGTAAGGCTGGAAACGGCAGGTACCGAATA
TCGCCTGTTTTCTGTAGTACACGTATCCAAGCTGAAGTTGGTCAAAGAATATCCGGATCGGCCGCAGATCCGTCTTTCGGTGGATGGATCCGGCCCCGTC
GACTTCGACGAAGTCCTCCTACCAGAAGATAGTTGGAACGTGGATCTCGAAGCCGACGAGTTCGAAGTCGAGAAGATCACCGATATGAGGTCGGGGAAGC
GAACTAGATACGGACGGATTTACCGTGAATTTCTGGTGTATTAGCGTGGATATGACGAACCCAGTTGGGTAGACGAGGCAGATCTGAACTGCGAAGCATT
ACGCTATGATTTCTTGCGGGATCGTACGAATCGGAACAGATTCGGCGTGATGCAGTCTCATGAAGAAGAGTAGGAGGGGGATCCATGGATGTAAGTTGGT
CATGTCGATGGGAGGATGAAGAAGGGCCCACAGGAAGGGTGTGGGCCAGGAGGAGGAGG