Description :
From Genome Similarity Track
Location :
Scaffold_1598:29- 2673
Transcript NameFunction/comments
Pytiw_DAOMBR242034snap-piw_contig_1598-abinit-gene-0.17Pre-mRNA polyadenylation factor
Pytiw_DAOMBR242034maker-piw_contig_1598-fgenesh-gene-0.060S ribosomal protein L21-1

Sequence
2644 bases(100 bases per row)
TGACCAGGGAACCCTCGCGGCGGCATCCCACCGAGAGGACCTCCATGCGGCGTATAGGACGACGACTTTGCATCATGCGCTGGCTGGGTCACGGCAGCAG
AGACCGCCTGGCGGGCAGCCTGCTCGCGGGTCTTCTCCATGGCCTGGTCGCGTCGCAATCGCAGCTGGCGACTCGCATACTCCTGCAAAGCGATAAATAC
GTTAGCACACGGTTCTGCCAAGCAAGAGAAGTGCTATTATAACAACGTTCTTACCCGCCACGAGTGCTCGTCAAAGCCGTAGTTGAAGTAGTCCGAGATG
TCCACACCAGGCTTTCGCCACGGCTTATCCTCTAGCATGTCAATGTCCACGTCGAAGGCCGTGCGGCGGCCACCAAAGAGCGCGAGGTCGTCGACCCCGG
ACGCTTCGCCCTAAAGTACATCCATCCATCCAATACAAAGCACAGTCAGTCTTGAATGCACATAACAGCAACATTGTGGGAGATAGGAGACACGATGCGA
ACCTCGCCCTGCTTGGTCTGGTGGTGGAGATGCGACGAGCCCACTGGGATGTGCTGCGAGCCACTGGGGAAACCACCACGCACGTAGCGATTCGATGCCG
CTGCTCATTCCAGCACAAGCAATCGTGAGTTCATGCAATAGAACACAGTCGCAAGGATGATGATATCGTAAGCATACGCACCTCCAGTGAAGCGCAACAT
GGGTTTGCTGCCTTTCGAGTCGTTGTTGAGCACGATCGCAATGTCTTCCTCGTCGTCGTCGTCGTCATCATCGTCGCCATTGTCATCGCTCGGCTTGTTC
TAACAAAACAACAACAGTCACCAGTCAATATTAATACAATATATCACCATCATCATCACAACAGACGCACCACAGTCGCTCCATTAGCGCTGCTAGACGG
CGCACCACTCCTCTTGTCCCCAGCCGATGAGCTCAATTTGATCGAGACGCCGCCGTAGAGCTCTTCGTCGTCGTCGTCATCACCAGTAGGAGGCCCTGCT
TCGTCGCTCTTGCTCTCGCCTTTGATCGCGCCATTCGTAGTCACGGACGCCTGCTTCTGGTTCCCGCCCCAGCCGCCGGCCCCGGCTTCTGCGGCCTCGC
GCTTGCTCTCCTTGGCCGTGAGCAGCACGTCTTCCCCAAAGTCTTCGTCCTGCGGACCACAGAATAGATATGCAAAAGAAAAAAAGACACACACATGAGC
CCATGCATCAGTAACACAACACCACATGTTGCCACACACGCGCCCTCGTCCAGCGCTCTCTGCGTCACGCCGCACGCACCTCCATCTCGCAGTCTTTGGC
TCGGATTCACCTGTTCCCAATATTCTCCACAAGGGCAAAAGTCACCAGCTACAGTGACAATCTCATAAAGTACGAATCGAAACGGGTTCTGACCCGTGGG
TTTTGACAAAACCCGTTTTGAGGGGGCCGGCGTGATTGGCTCGTGGTCCGATGACTTGGAGTTTGTATGCTGACGCCTTCGCGGCCAATAGTTTTCGCTC
TTGGGCGCTTGACTTGGGCGCCGCCGCTCGCTGGCGCCGCGGAAAACCAGTTCTTGTCTCGTTCAGATCTGCAGGTAAGCGAGCGCTTGTTGGCTGCGTG
AGGGTGCATGCGCGTGGATGTGGGATCGTGGCGATGGCTGCTGGTCGCTGGAGGTGGTGGCTGCTGGCGTGATGGACGGTTCATGGAGCTGCTGGTGGCG
ACCGAGTGCGAGTGGCGAGACAGCGACGAATGGCGCATGAACAGCGAGAACAGAGCAGCATGGCGAACAGCCAGCATGGACACTGCATGATACACAGAGC
GGACAGGAAACACATACATGGATGGACATGAAAGCTCGACACCTTTCGCGAGCTGGATACCATCAAGTCGCTCACGCGCGACGATTGGCCGAGTGACTGC
TGCACCACGTGGGCGTCTTGTGCAGCAGCAGACGACCGAGATAGCGTAGTCACCACCAGCCGATTGCCGCACCAGCTCAGCCTCCACCACGCCCACCCCC
AATGCACTTGATGGATACATATCGATTCGATGCTAATGGTACCTCTCTGTTGTGTTGTGACGAACAGGAGAAACTAATCAGCCATGCCGCACTCTTTCGG
TTACCGCGCGCGTACGCGCGACATGTTCGCTCGCCCGTTCCGTCAATCCGGAATGATCAAGCTCTCGACGTACCTGCGTACGTTCAAGGTCGGTGACTAC
GTCGACATCAAGGCGAACGGCGCAATCCACAAGGGCATGCCGCACAAGTACTACCACGGCCGCACCGGTCGCGTGTACAACGTCACCAAGCGCGCTGTCG
GTGTGCGTGTGAACAAGATCGTGGGCAACCGCGTGATCCACAAGCACGTCAACATCCGCATTGAGCACGTGCACCAGTCCAAGTGCCGTCAGTCGTTCCT
CACGCGCGTCAAGGAGAACGAGCTCAAGAAGAAGGAGGCCCACGCCACCGGCGGTACGTCTCTCTTATCGCCTCTCTTGGTGGGCTGTTGTATCACTCAC
TCACATGCCATCTCCTGTGTATCTTTTATAGTCCGCGCCGTCATCAAGCGTCAGCCTACCCCACCGAAGGAGGCTTACACCTTGAAGACCAAGGGCGTGG
CCCCGATCACCATGGCCCCGCAGCCATTCGTCGACCTTATGTAA