Description :
From Genome Similarity Track
Location :
Scaffold_2072:29- 1557
Transcript NameFunction/comments
Phyta_totarag14073hypothetical protein

Sequence
1528 bases(100 bases per row)
agcAAATTGTTgcttttggccaatcacagcCGCCTTTGCTGCGCTCAACGACTAAAGGTttttttggccaatcaaaatgcgTTTTAAGATTTCGTGATGG
ACGGACACACACCATGTTTCCGTAGATAGTTTTAAACTAATCGAGCGGCGCCCGCTTCGCGGGCGGTGATTCCAGGTTCAGTCTCAGTAGTGGGGCGGGC
CCGACTCCGCTACGATCCGGCGGGCTGTAGTACAAGTTGAGCGACACGTCTACTCATACAAATGTTCAATGTAGTAACAGCGCATGTATGCATTGTTAGC
GTAACCTAATCACATATCTGCCTGTTCACTGTGCTCGCCATGTACACtccgtcctcttcctccagctctggATATTCGATAAGCGCCTTGGACCTCGATT
TTGCGGTAACCCTCGACAAAGCCACATGCAGCTGACCATGCGAGAAGCCAGGTACAATCCCAGGTACTCCGCTCTTTGCCCTTGCGCTTTATTGATGGTC
ACGGCGAAGGCAGGCTGCACCGGGAACTGCTTGCGTCGCAAACGGTACAGGAAGTCGCGAACGTCATCtctgctgatgaagacgattCTGGAAATCAACA
CGTGCTGTCCTTTATGACTGCCCGTCATGATCGTGACGTTTATTCCATGAGGCTTGAGCTCCACACCCCACAGTCGTGTCCCGTTGTACAAACCCAGATC
AGGGTTTAAGGTTCGCATCATCATGATCGGAATACTGTTCTTGAGGTTTAGCTTGTGTGGAGGGATTTCACTGAGGTTGATCGAATGGAGAACTTCAGGC
TCGAAGTAGCTCTCTCCAGAGTAGTAGAAAATGTACTCGTGGGACGTTTCAGTCAGACGCTCCGCGATCGCACCATTGATGCGGTGTGCCATTGCGTTCG
TTGTTGTCAAGATCGTGCGACGTGCAAAATACTCATCCATTGCTACTTCCGGGTTGCTGACATCGGTGTACATCTCGTCGATAATCCGCGTGAGGCCTTT
GAGAATAGGCCTCGGAAGCATATTCTCGTCCCCATCTTCGTCGGACAAGGCCGCAGGGTTACATGTCCCACAGGAGTTTCTTGTAGTCACTGCCAAGAGC
GTCGCTCACGTCATGTCTCACTTCCCCCACCTTTATAAGGAAATCGGAACACACGTATTTCCCCCGCACTCGTTGAAGTATGGACTCGCGCATGTACTCT
GTGAGGCGAACTTGCTGGAAATGGGGCCACAGCCTCGATGTCTACAGACAGGCATCGAAAGTTTCTGCAGGCGAGCCTCCTTTAATCACTGCTAGAATGT
GTCTAAAAGCCCCCGTTAGAACAAAATCTTCTTTCAAAAGGGTTTGACCTCGTTGTTCATCACGCCCCGCAGTGCCTGTCGTCCGCCTCGAAAGCATGCC
AGTTAGCCATCGGCGCTTCATCCCAAATGACCAAGCTTGCTTTCCCCAGCAACTTCCTCAAGTGGGACTGTTTGTAGATGTTGCAAGTCGAATTCTCGTC
TAGTTTCAACTGGATCTTAAATGTGGAA