Description :
From Genome Similarity Track
Location :
Scaffold_3253:29- 1330
Transcript NameFunction/comments
Phyta_totarag15173protein T04A11.11 putative

Sequence
1301 bases(100 bases per row)
ATTCAGTAGTGGGTCTTGTTACCTTTCTTATCTACTACTTCCACGCATCGACGCGATAAGCGACACCAACAAGGCAGTGGGAATCGATTCCCAATCCTCG
AACAGCGTAACCTTCAACTTCGGCACGCTATCAAACTGCCTTCCATTAGTATAGACTCTCCTGCTCATTATAGATCACAGATGTTCTATCGGGTTTAGAT
CTGGAGACTTCGATGGCCAATCTAGAACTCTAACGTCCTGCGCAGTAAATAATTCTTTCGTGCGCGTTGACACATGGATGCTAGCATTGTCCTGTTGGTA
GATATAATCTATACCGTAGTTTAGGTGAGCAAAGGGGAGGAGATACTCAGAGACGGTGTAGACTCAGTCGTCCGAGTTCTGCCTCCCCGTGAGTACCACC
AGCGGCGACTTTCCGCGCGAACTGAAGGCCGCCCAAACCATGACAGACCCACCGCCAGCTTGCTGTCGCTTGGTCTGGCGGGGCGGCTTTTGCAGGTCAT
GCCAGTAGTACTGAAAGCCGTCGGGCCCGTCAAGGTTCCACTTCTTCTCATCCGAGAAGATGATGGTGTCCCAGACGGCCCCGGCGTCTTTCCGTACTAG
CATGGCGCTGGCCCATGCCTTGCGGGCCAGCATGTCCTCGGGCTTGAGCTGCAAGGTGTTCACCGGCCAGTCCACCCTTGCCAGGGTGCGCTGGATGGTG
CGCACTGAGACggacagctgcagctcggccTTGAGCTTCACGGCCGACAGATCGCCCTTGGACGCAacgcgcagcagccgccgtGTCTCGCGTTCGGTGA
GGGTTGGCTGAGGGCCCGGACGCTTGGGTTTCTTGGGAGGGACGGGGGAGACGacgcgactgctgcgcgcCGTGACGCGGGCGATATCGCGGCCGCTCAC
CCCAGCGAGATGGGGGCCTTCAATCCTCCCTCGCTCACGCTCCGTTAGCCGGGGCTTTTTCTTGGTGGGCGGGGGCTTCTTCCTTGGCATCTTGCGCAAT
GAAGTCCGCAGGCATCCACACAGCCGGCACTATACCGTGCTACCATTCGTTTATTGCCATCATTCCGCTATACTTGTTTATCNTTATGAGCCTGACTGGC
CGATCTATCCTGGCGCACTGCCAAAAGCACCACTTTGTATACTGGCCACGTGAAGGACTGCGAAATGCAGCGCGTTAACACAAACCTCGTATTTCTACCA
ATTAGAGCTCTAACATATCTAAATAGCGCGCGCTAAGTCTGACAATTGAGCGAGTTACGGCCACCGACGTGGGTGGCCGATATAACCTGGCGCGGAGTGT
A