Description :
From Genome Similarity Track
Location :
Scaffold_3085:29- 1311
Sequence
1282 bases(100 bases per row)
GCGTCTGTTCATCTCTTTCTTCCTCGTGAAGTTGGCGTCTAACTTCTCGATGTTATTTGCTAGACTTGGTGATCCTGTAAACAAGGTAGCAAAAGAGTCT
GGACAAAGCGGTGACAATGACCCGAGAAACCCAGATGTTAGAAGTCTTTCTGTCAAATTCAATGACACCAAAGTTAAACCAACAACTCCCCGACAACCTA
AAGTGAAGCACGAGCCCGATTTGAACATCCCCAAGCTGGTGACAAGTCCCGACAAGCAGCAGCAAAGGCAAACACCTTATGTCAAAATGGATCCAAGCGA
GTGGAGCATGAGTCTTCCAGAGATCGATTGGACAGATGAAGATGAACTTGTGAGTGTGCTGATTTTCGGGCGGCTCTACACGACCATACCAACACCCTTT
CCTAACTAGCTAGCGTGTCTTCTACAGATGCTGCAAAAACTGGATTCGGATGACGCGGATGTTGATGCAATGCTGCTACTGCCCGCAACAAGTGAGACAA
GCAATCCTGCAGCTGGCGAAGGGGAGAAGAACTCACACAAAATCGCTGAGCGCGACAGGGCCGAGAGCAAAAAGAGACTCACGAAACTGATCAATGCGTC
CATGAACACTGCGACAATACGAAAGCCACGATGGCGGCTCGAAATGGACACAGTGACTGGAGCGGTCTCCCCGTTCAGCGACCAAGAAGTCAAGCCGACG
AAGCAGCTCCAGATATTTCGGTCGGCAGCGTATGCGGTGGTTTTCACGACGCATCTCCGCATGCTCTTGCAAGCAAAGAAGCTGGAGCAAAAAGAAAAAG
CGATGCAGGTGAGCGCGATTAGGACTTTTTATTATGGAGTGCAATAGGAGCGAGCCAAATTCTGAGTTAGCTTTGGCATATTCTAGGATTTCGAGTCGAT
GCTGAACGTATACTTTGACGCCACGCGCGTCTGGCTTGGGAAGATTGTCCGGAATCCGTTGCTGTCGATTCTTCAAGATCCGGGGCTAGACATCGACCTG
AGCGGCAAGTCATCTTCAAAAGGGTTTTCAAGCAAGTTTGGCGCTCTCTTTGCTCTTCGGCCAAAGCAAACCAATACAAGCACGACTGGTGTCGACGAAG
GCAAGTTTGTGAAGCTGAAAGTACGGGTGAAGGGAATCGTGGACGCGATCGTCAAGGCAGTCAACAAACAAGACATCCCAGCTGGTATTCTCGAGTTTTG
GAAGCGCCTCACGTCCGATGGGTTGTATTTCCCAGAGAGTGTAAGTCAAGCTACTGAGTTGAATCGGACTTTGCTATTTGGG