Description :
From Genome Similarity Track
Location :
Scaffold_829:29- 1304
Sequence
1275 bases(100 bases per row)
TCCTTGCCCTTGAGAACATCTTCGATGATCTCTTCGAGCTCGTGAATGTCGGCGACTCGAGCGTGGTAGAGACTCTCCGCTAGCTTGTCATCGTCGCATG
TTGCCAGGAACTGCTGTACGTGTTCTTTCGCGTCGCGACCACTCTTCTCAAAGTGTAGACGGGCGGTCCGAGCGTAGCCGTTCAGCCTGTTTATGTAGTC
GCACAGATGTTCATTTCGTTCCCGCTTGGCGGTGTAGTAACGCGACAGTGCCGTCTGCGTGACCTGCGAGCAGTAGTAGCGGATGAACGCATCGCTCAGC
AGCTTCCACTTGCGCTTCGTCTTCTTCGGAAGTTGACGGAACCAATGAATGGCTCCGTCTCGGAGACTTAGCTCAAATGGAATGCACCATTTATCGGCAT
CTGTGTGGGTTCCAGTCATTTCATAGACGAACCCACGGAGCCACTGCATACAGTTCTCAGTTTTGTTGCGAGAGCCTGAGAACGGCGTGATGCGATCCAG
CGGTCGGTGCGAAGCCATTTCAATCCTCGGTGTTGGGTCCACGTCGTTAAGCGTCGCTAGCTCATTCATCTGACGCATCAACTCGAGTTGATGATCTTCC
TCGTCGAATGTACGCACCAAAATGTCATTGTCACTGGACGAACCATCGCTGTCGACTTGACGACGTCCGGCACCACCTTTGGGAGCCCGCGCACCGCCTC
TGCGACCGAACGAACCCTCGTTACTTGCGTAAATACGCTGCATACGGCTCTTCGAACGTGGCGTAACCATGTGCGAGTCTTGAAAGTACGGTGAAGCTTC
GGTAGTGCCAAAGGCACCACGCTCAGCTCCACGCTTGGTCGGAGGAGTACGAACGAGTCGTTGGGGCGTCGGCGGCAGTGGAATCTTAGACGGATCTTCA
TCTTGAATCATCGGTCGACTCACAGGCTGCTTTCCGGCATTGATGCCAACAGCGCCAAACGCCTTCCGAAGCTTCTTCTTCCATTTCTGGAGAGCAGCTC
CGGCTTCGTGTGGACTCCAATCCTAGAGCGACATCGTCGATGGGTACGTCTCGTTCTCGAACCCCAGCGACAACAGTAGCGAAACTGAATCCTCGGCAAC
TTGGCTAGTCGAAACCGAGTTGACTGGGTATTGAAGTTCCTGCGCAAGCGCAGGCCAGTCGGCTTTTTTCTTGGGGATGGGCTTGAATAGCTGCATCCAC
TCATCATTCTGCATCAGCGCTTGTACGCGGTCGAAAACGCGCTTGGCGGCTGGTGTATCACCGTTGATAGGTGTG