Description :
From Genome Similarity Track
Location :
Scaffold_552:29- 1226
Sequence
1197 bases(100 bases per row)
CGCGTACGCTTGTTCCACCTGAGATCCATGATCTTCTCCACTTCATACTCGTCATTCTCGTTGTCCGCTGCCCAGCTGTCTTCGGGAAGAAGTGCTGTGT
CAAAGTCATCGTTGTCTTCGATCTCCGGTTGGATTATAGGCCGTCTGGGATACAACGCCCGGGGTTTCAGTCGACTGATGTGAACCCAAGGGTTTACACG
GTAACCCGTGTCCTCAACCTTGAGCCTCACCCGGAACTCGTCAACCACTTCGGCGATCCTGAATGGACCATGCCATAAGTGGGCCAACTTTCGACTCAGA
CCCGGCTGCACTTTTGGGATGTACAGCCAGACTGCATCCCCAACGTTGAAACCTGCCTTGAGCCGGTCTGACAACTCGTTGCACTTCCGGGTTTGCTCTT
CCGAGCGAGCCCGTTTGGCCTTCCTCTGGAGGTCTACTGCACATGCCCGAGCGTAGCCGTAGTCCCGCTGGAGTTTCCTTCGCCACTCATACGCGGTCCG
TTCAGGGACACTGGAGGGTTTAGGCCCCAGCATAGCTGAGATCGTACTCTTGGCGTCCCAACCGTGGACCAGGTAGAATGGGGTGTCCAGCCGGGTTGCA
TCAAACGACGTGTTGAGCGCGAACATGAGTCTCTCTGCGGGGTCATCCTAGTCGCTCTGGTCAGCTTCTGCGATGTAAGTCCGGATGGACCTCGCCACAG
TCTGGACGGAACGTTCCTGCTGTCCATTCGCCTGGGTTCGGTATGCCAACGTAGCTCGCTGTCGGCTACCCAGAAGTTCCCTGAACCGAGTGAAGACTTC
ACTCATGAACCTGGGATCCTGATCGTGACGCAGTAGGGAGCTGGCTCCGAAGCAGCGGAACACCCTCTCCTCATACGCTTCAGCGACATCCTGACCGGTG
GTAGAACTCATCGGTTTGCACATAACGAAACCCGAAAACGCATCCTGGAACAGGAGCAAGAACGTGTTACCCCGTTCGGACTTCGGCAAATGGGTCATGA
AGTCCATCGAGACCACTTCGAAAGACTCTCTGGGCTCGATGTTCCCGGGCGAAGGTCCTGGATTCGGCGGACGCCCCTTGCCACTGGCGCAGTCGGTGCA
CTACTTGACGTATCTTTCAACATCTGCGTACATCCCTGGCCAGTAGAACTCCAGCCGGAGTTTCTCGTGCGTCCGGGTTATTCCCTGATGGCCACCT