Description :
From Genome Similarity Track
Location :
Scaffold_2610:29- 1190
Sequence
1161 bases(100 bases per row)
TCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAGGTCTAGCTCGAAGATATCCTCTGCGTCGAACACCCCAGCT
ACGACGCCTGACTCCGTAAGCAAACGTAATAGATCTTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTCGA
TCTGACGTGGATTCAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCTGACCAGCTTGACCTGGATCCAG
CTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTTTCTCGTTTCTTCGACTAGCGGGCTTGGGTTTAG
GTACGGTGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTTACTTTCCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCA
GGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTTTCTTCTAGATCCGGATCCACCTCTCTTCCGTCGATAGAGTTCCTCCCAAAACTCCATCGAT
CCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACTTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTC
ACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCAGATCCAACTTACCAAC
TGCGCCCAGACACCGACTAACGGAGGGGATTCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCTGGATCTTGCTC
TCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAACTCTTCACTCTGCGTCC
GTGGATTGTTCCGAATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGGCCGTAGGGTTGCCTTGCGGGTGTGTTCCCTTGC
CTTTGTAGTTTCCTTTGCGACGTACTTGCCGCCTCCTGTGACGGGATCTTGAGAGTTGAGA