Description :
From Genome Similarity Track
Location :
scaffold_2485:29- 1067
Transcript NameFunction/comments
Pl_100014hypothetical protein PHYSODRAFT_323774

Sequence
1038 bases(100 bases per row)
GGGCTGTTCCCACCCGACGCGGGCTCGGGCTCTCCGTTATTCCTGGAGAAGCTCCGAGCTCCTCGTGGTCAAATCCACGGTCGCATCTCTTGGGGAGTCT
ATGAACGAGCACTCGTTCAAAGGGAGCCGCTCTTCACTGATGATATTGAGGCGGCTCGATGTGTGCTGCTAGCAGCACACCGAATTCCTCTAAAGGAGTT
CACTAGCCTCCACAAGAAGCCGGGGATCATGGTGGACTCTTTCTGGTGTGGGGCTACAGCCCGAGTACACCACAACTCCCACGCAGGCTGATAATCTGTT
CTGGAGCTATGAATCTATGCAGAGCTACTCAGTTCAGGAGATGAACGAACTCCGTGAAGATCACATGCTGTCCCACGTTTTGGACCAGCGCGATCTTCGC
ATCGAGTTCTCGCACCCCATCTGCAAGCGCCAAATCCATTCCACCGTGGACAGAATGAAGCAAGCTGCTCAGTCTGGCGCTCAAGATGAGCGCGGGTACG
GCATGTACTCTAGTGCCATTCCCCGTAAGTCGGCTAAGAAGCCACGGTCTACTTACGAAGCTGCCGTTGGTTCTGGTCCCAGATCGCAACAACCTTTGGC
TAGTCTGTCTGGAGCCGATCTTCCGGCTCCCACGAGTTCTGTGATGGCGGGTACCCCCGCCACTTCACAAGCAGCTGGCGCTTCCAAGAGCGCCGGCGCT
CTTGGACAACCCGTTCCACATGGAAGTGGAACTCACCGTTCCGGTCCAGGAGAGCAGGTTGAGCTCTCGCACGCTTACAAGTACGAGGCTCCTCAGCCCC
AGTCCCCACGACCTTCGACTTCGGGTCGGGACTCTGGTGAGTCCTATTGGCAGGGGGCACTCCGGCAACTTCGTGATCGCGTGTACGTGATTGAGATTGC
CTTGGGCATTGGCCCTGATGGTCAAGCTGCTTCCCAGGCGGGGAGGCCGGGTACGCTTGAGTCCCTTCCCTGTGCTATGGATGGCCTGGGACGCGAGACC
CGGGAGCTTCATGGTCGTGCCGACTGTCGATCTCCGGC