Description :
From Genome Similarity Track
Location :
scaffold_5:289970- 292912
Transcript NameFunction/comments
g8152.t1 C2 domain-containing protein, putative

Sequence
2942 bases(100 bases per row)
TCTCCTTCAGGGTGCTCATAGTCGTCAAAGCCTAGTACCTTGTCCGCAAAACTGAGTGCCGTGTATTGCGAATCCATAACCAGACCGCCTGCACCCGTTA
CAAGCAGTGCAGCTAAGCAGCTACGCAACTCTTCTTCGCTCATATGCTCACCGGAGTGCAGTAGCCGGGCTTCGAGCTGGTCCCATTGTAGTGTTGCTGG
CCCATCGACCACATTGTCACCAATCGCGTTTGAGCTTCTCGACACGGAAGCAAGTATCTTGAAAGCGCGCTCGATCTGTGCCTTGCCAACTCCGAATACT
GGTCGATGGTTAACGTACAGCTTGATGAAGTCATGCAGCCCGATACTTTCAACCGGCCGAGACGTCTCGGTAAAACGTGAATAGCGAACTTCGCTCACCA
TGTGCTGGATCTCTTCGTCTGTGGGGTAATAGCCCAGCGCACGCATGGCGTTTGGTATCTCACGCAGCGGAATTTGAGCAGTGATCTCGCGGGCAGCGGT
GGCATCCTCGCCTTGGACACGAAGCTGGGCCAAGTAGAAGTAGTCGATTATCTCATGGTAAAATGACCCCTCACGGCCACCTTCCAGCAGTGCCAGGTAT
GGTGCTAGAGCCACATCGTCTTCGCCCAGCTCGTTCTTTGCTGAAGTACGTGTATCTTCATCACCAAGGTCATCCCCCAACTGCTCCTCAATACTGCGAG
GAGTGCCCCGAGCCTCCAGTAGGTCTAACTGATGAGTGTGAATTTCCCACATATTCACCACAAGATCATCCCCACCGGCAGTGAGCAAGTGACTCCCATC
AAAGGTGACATCGACGTTGCTGATTTTGCCTGGATGGGCAATGAGCCCCATGGCCTTGTGCGGATTGCCATCGAGAGGGAGCTTTAGCAGTCCGACAACC
TTTTCGTGCGTACTGTAGACACAGTACCGCTCCGCTACGCCACCGGTAGCCTCAGCAGCTATTTGGTCATCCTCTCGAAGCGGTACAGGAACCAATCTGT
TGATAGGTCCACCGTATGAAGGACCTAGTGTTGTCTTCCGGCACGTCTGGTTGCCTGTATTCCACTGCTTCAGCTTGTACTCATCGTTAACCACGATAAC
CAAGTCCTCTTGCACACCACGCAGCTCGGGGTGCCAACAGCACGCAGTCGGTACAGCACTTTGCTCTACACGTGTTGGGGCATTCTTGAGAACGACACCA
TCCAGGATACTTGACCGCTCCAGGCAGTACTCAGCTAAGGTGCGATCTTCACTTACGGATACCAACACGGGTTGCCCGTCGCCATCCCTCGAGAACTCGA
GTCCAGTTACGGGCTTTGAGTGAGCTCGGCAGCGGCCCAAGTATACCCATTCATCAGCGTCGTCAGAGCCATCGGGGTTAGATGTAACTTGCTTGGCGCG
CCACATACCGAGAAACAAGTTGGCGTCTAGTGCCACGAAGAGCGATGAATCAGGACTAACTAACACATCCGTGATAGCAGCTTTTCCAAGCCGAAACGAA
GCTAGATCATCGAGCCGATGTCCATGCAGCACTTTCACGATACCGCTGGTGAAGCCAACTACGAGCTTTCGGCCATCGCGAGCAAATGTGAGGCACTGCG
GACGGAGCTTCTCTGATTCAAAGCGTCGTACCATGATGAGCCTCTTAGCCGCGTAGTCCCACAGCTGCACCACCCCCGAGTAGGAGCTGAGAGCAAGCTG
AGGAAGTCTTGGATGCGCAGCAAGTCCATGAATGGAGTCGTTGATCCCCTGCATGAGCAGTGTACCTCGTCGCCGCTCAGGCTCATGCTCAGCAAATAGC
CCCGCACTCATACCAACGATGAAAGCCGAGGCTGTAGATACAATAAACTCAGGAACGTGGAAGGACTCGCTGTCTGCATCGTCCCCACCTGCACGACCGA
GGTTGCTGTCAGCATCGCCATTAGTTGCATTCGCAGGAAGAGCAAACGACACACTTGTGACCGGACCAGCATTCATGTCTTCAAACCAGGCCACCAAACG
GAAGTCGAAGTCATAAAAGCGAACAGCACCATCACTCGAGCCAATAACAAGATAGCCGTCCATATCTACGAGAGCGGTTAATGCTACCTTGCGCTGTGGC
TCAGCACCACCCGCGAGCCGCACAATTTTGACCGCCTTTCGCTCAGGAAAACTCCCTGCGGGAGTCTCAGCACCATTATCGCTTTGAACGGCATCCCAAA
GCACGAGATCGCCGTCTTCTGTTCCAGTGAGTGCTTGCGCAGAGTCTGGCACAAACAGTGACTGCGTGAAGGCCCCCACCACCTGGCGAAAATCTTTCTG
CGCCAGCGACGGAGAGTAGAAGAGCAACGTGCGCGCTGCCCAGCTCCAAAAGATCACTCGCTGACGGCCTGTCGTGACTAGTTCTCGAACGTCGTACGTG
TTGAAGCGCACAGCGTGCTGCACGTCTTCTGTGGCTACAAGTGACGAGTACAAAGGCTTTGATACTGCTGCCCCGCTCGCTGGGGCGGCCCACTCCCAGA
CTGCCAGCTCTTGATCAAATCGCTTTCGCGCTGTATTCTTTGCCTCTGTAGTCTCACGTCCGTTTTCATCTTCACGGTTGACAGCACTCAGCGTAACCAG
GAAGAGCGCGTCGGGCGAGATGTCAATAGCTTGGACGCCGTTCGCGTGTGGTCGAAATATGGTTCGAATCGGGTTACCCGACTGAGCGTCCCAAACGACT
AGCATCGACTCGTGACCGCGGTCAGCCGTGACAACCCATCGCTTATCCTCACTGACAACGCAACAAGATATGGGGTGGCAATGACCTTGTAGAAGTCGTT
GCTGACGGCGGGCATAGTCGTAAATGACACCGGTGTGAGCAGCCGCATAGAATACAGCACGACGCGAGCCTGCCGATAGACTGTGCACGCCGTTGATCAA
ATCCTTCTGAAAGCCGAAAGTCCAAGCCAATCGCAGTGCGTT